Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0613374729:

Variant ID: vg0613374729 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 13374729
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAAGTCTCAATTTACTTTTATGGAATAATAGATTAAGCATGTCCATGTAAAATACATTGTTATACAAATAAACTCGACCAATGTGCTATTGTATTATT[G/A]
AAGGTCACATTAGTATATTTAATTAGTTTTTAAGAAATATCAAAGCCTAGAAGTTATATTGGATAATTTTTGGATAATCTAAAGGAAAGCAAATTCATTT

Reverse complement sequence

AAATGAATTTGCTTTCCTTTAGATTATCCAAAAATTATCCAATATAACTTCTAGGCTTTGATATTTCTTAAAAACTAATTAAATATACTAATGTGACCTT[C/T]
AATAATACAATAGCACATTGGTCGAGTTTATTTGTATAACAATGTATTTTACATGGACATGCTTAATCTATTATTCCATAAAAGTAAATTGAGACTTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.90% 0.00% 0.00% NA
All Indica  2759 96.40% 3.60% 0.00% 0.00% NA
All Japonica  1512 9.40% 90.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.30% 2.70% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.80% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 18.70% 81.30% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0613374729 G -> A LOC_Os06g22919.1 upstream_gene_variant ; 774.0bp to feature; MODIFIER silent_mutation Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0613374729 G -> A LOC_Os06g22919.3 upstream_gene_variant ; 774.0bp to feature; MODIFIER silent_mutation Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0613374729 G -> A LOC_Os06g22919.4 upstream_gene_variant ; 774.0bp to feature; MODIFIER silent_mutation Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0613374729 G -> A LOC_Os06g22925.1 downstream_gene_variant ; 4666.0bp to feature; MODIFIER silent_mutation Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0613374729 G -> A LOC_Os06g22900.1 intron_variant ; MODIFIER silent_mutation Average:48.72; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0613374729 8.13E-13 4.00E-77 mr1033 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 3.14E-06 5.64E-10 mr1033 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 2.74E-11 3.17E-16 mr1033 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 6.44E-06 8.86E-09 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 1.49E-06 2.65E-08 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 6.99E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 6.32E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 8.77E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 4.91E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 4.93E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 2.57E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 4.11E-10 1.19E-44 mr1176 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 2.78E-07 mr1176 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 8.60E-08 1.32E-10 mr1176 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 8.12E-07 9.99E-09 mr1204 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 1.12E-14 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 1.01E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 2.66E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 2.09E-07 mr1436 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 1.58E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 3.52E-08 3.52E-08 mr1536 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 1.96E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 6.92E-13 1.29E-99 mr1033_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 6.68E-12 mr1033_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 1.67E-13 1.35E-21 mr1033_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 NA 1.07E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 3.91E-07 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0613374729 4.78E-09 1.09E-10 mr1536_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251