| Variant ID: vg0613063818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 13063818 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: Unkown |
Inferred Ancestral Allele: Not determined.
GGGCATGTTTAGGGTTTATTATTCTTTGACATATCCAGTCCATAGCCGATTTGGTCTAACTTCATCTGTTTAGACCATCAACGATATGCTATCGGCCTAT[C/T,A]
GGCCGATCGGCTATCGGTCGACTGATTCTGCTTTTATTCTTTCTTGCTGATTGCAGAATCAAATCAACTAGCATGCCCTTGACACACTTGAGGCTAGCCT
AGGCTAGCCTCAAGTGTGTCAAGGGCATGCTAGTTGATTTGATTCTGCAATCAGCAAGAAAGAATAAAAGCAGAATCAGTCGACCGATAGCCGATCGGCC[G/A,T]
ATAGGCCGATAGCATATCGTTGATGGTCTAAACAGATGAAGTTAGACCAAATCGGCTATGGACTGGATATGTCAAAGAATAATAAACCCTAAACATGCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of Unkown(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 0.00% | 0.72% | 3.55% | NA |
| All Indica | 2759 | 92.90% | 0.00% | 1.12% | 5.94% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.40% | 0.00% | 2.52% | 6.05% | NA |
| Indica II | 465 | 92.30% | 0.00% | 0.86% | 6.88% | NA |
| Indica III | 913 | 93.80% | 0.00% | 0.44% | 5.81% | NA |
| Indica Intermediate | 786 | 93.50% | 0.00% | 1.02% | 5.47% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0613063818 | C -> T | LOC_Os06g22470.1 | upstream_gene_variant ; 1612.0bp to feature; MODIFIER | N | Average:41.986; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0613063818 | C -> T | LOC_Os06g22480.1 | upstream_gene_variant ; 200.0bp to feature; MODIFIER | N | Average:41.986; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0613063818 | C -> T | LOC_Os06g22470-LOC_Os06g22480 | intergenic_region ; MODIFIER | N | Average:41.986; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0613063818 | C -> A | LOC_Os06g22470.1 | upstream_gene_variant ; 1612.0bp to feature; MODIFIER | N | Average:41.986; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0613063818 | C -> A | LOC_Os06g22480.1 | upstream_gene_variant ; 200.0bp to feature; MODIFIER | N | Average:41.986; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| vg0613063818 | C -> A | LOC_Os06g22470-LOC_Os06g22480 | intergenic_region ; MODIFIER | N | Average:41.986; most accessible tissue: Minghui63 flag leaf, score: 54.348 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0613063818 | 1.83E-06 | 1.41E-09 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | NA | 2.13E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | NA | 5.33E-31 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | NA | 2.92E-07 | mr1075 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | NA | 9.82E-06 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | NA | 7.02E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | 3.86E-06 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | 4.26E-06 | 5.63E-09 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | 3.15E-06 | 4.61E-07 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0613063818 | 6.44E-06 | NA | mr1096 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/