Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0612574686:

Variant ID: vg0612574686 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 12574686
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGTCAGGGGCGGATCCAGGAAAAAATAGTAGGTGGGGCTGAACAGACTCTACCCTAGACCTCTTTAGCGGACTTATATTCTCGTGGTTGCGTGGAGGAT[C/T]
ACTGGTATCTGTGTTGTTTGAACTAGAATAATACATAAGCATTATTCTTTTTGGCATGTTGACAAACTAAAAATGTAGAAACAATTATAAATTTTAATCA

Reverse complement sequence

TGATTAAAATTTATAATTGTTTCTACATTTTTAGTTTGTCAACATGCCAAAAAGAATAATGCTTATGTATTATTCTAGTTCAAACAACACAGATACCAGT[G/A]
ATCCTCCACGCAACCACGAGAATATAAGTCCGCTAAAGAGGTCTAGGGTAGAGTCTGTTCAGCCCCACCTACTATTTTTTCCTGGATCCGCCCCTGACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	2.60%	3.00%	50.44%	NA
All Indica	2759	22.80%	0.20%	2.97%	74.05%	NA
All Japonica	1512	85.80%	7.20%	3.37%	3.64%	NA
Aus	269	16.00%	0.40%	1.49%	82.16%	NA
Indica I	595	33.30%	0.00%	2.02%	64.71%	NA
Indica II	465	11.60%	0.00%	3.01%	85.38%	NA
Indica III	913	21.10%	0.30%	4.16%	74.37%	NA
Indica Intermediate	786	23.30%	0.40%	2.29%	74.05%	NA
Temperate Japonica	767	97.00%	0.10%	0.13%	2.74%	NA
Tropical Japonica	504	70.60%	18.30%	6.94%	4.17%	NA
Japonica Intermediate	241	81.70%	6.60%	6.22%	5.39%	NA
VI/Aromatic	96	60.40%	3.10%	2.08%	34.38%	NA
Intermediate	90	56.70%	4.40%	3.33%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0612574686	C -> T	LOC_Os06g21770.1	upstream_gene_variant ; 2342.0bp to feature; MODIFIER	silent_mutation	Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0612574686	C -> T	LOC_Os06g21750.1	downstream_gene_variant ; 3606.0bp to feature; MODIFIER	silent_mutation	Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0612574686	C -> T	LOC_Os06g21760.1	downstream_gene_variant ; 434.0bp to feature; MODIFIER	silent_mutation	Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0612574686	C -> T	LOC_Os06g21760-LOC_Os06g21770	intergenic_region ; MODIFIER	silent_mutation	Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N
vg0612574686	C -> DEL	N	N	silent_mutation	Average:26.789; most accessible tissue: Zhenshan97 flower, score: 63.813	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0612574686	4.01E-07	5.99E-07	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686	NA	8.43E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686	1.95E-06	NA	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686	4.69E-06	NA	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686	3.03E-06	NA	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0612574686	1.92E-06	NA	mr1936_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251