| Variant ID: vg0612510076 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 12510076 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTTGCCTTTGTTACGCAACACGCCAACAAAGAACCTTGGTTCCGTTGCGCCCTGTATTCCGAGGCGACCATTTCGCGTGGTTCGACCCATTTCCCGATCC[G/A]
AAAAATCCGATAACGTACCTATATGAGTGGGATGGATGGTAAATCATTTGCAGTCTTTTTCGGCAGGACCTAGACACGGAGGTTCGGGAAGTAGCGCATG
CATGCGCTACTTCCCGAACCTCCGTGTCTAGGTCCTGCCGAAAAAGACTGCAAATGATTTACCATCCATCCCACTCATATAGGTACGTTATCGGATTTTT[C/T]
GGATCGGGAAATGGGTCGAACCACGCGAAATGGTCGCCTCGGAATACAGGGCGCAACGGAACCAAGGTTCTTTGTTGGCGTGTTGCGTAACAAAGGCAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 31.20% | 1.74% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.30% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 11.10% | 88.80% | 0.13% | 0.00% | NA |
| Aus | 269 | 83.60% | 11.20% | 5.20% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.10% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 9.50% | 90.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 42.70% | 6.20% | 51.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 35.60% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0612510076 | G -> A | LOC_Os06g21670.1 | upstream_gene_variant ; 2038.0bp to feature; MODIFIER | silent_mutation | Average:22.779; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0612510076 | G -> A | LOC_Os06g21680.1 | downstream_gene_variant ; 3665.0bp to feature; MODIFIER | silent_mutation | Average:22.779; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| vg0612510076 | G -> A | LOC_Os06g21660-LOC_Os06g21670 | intergenic_region ; MODIFIER | silent_mutation | Average:22.779; most accessible tissue: Minghui63 young leaf, score: 36.684 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0612510076 | 7.73E-07 | 5.20E-07 | mr1004 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612510076 | NA | 8.64E-11 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612510076 | 5.29E-06 | 5.29E-06 | mr1165 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612510076 | NA | 5.28E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612510076 | NA | 1.77E-08 | mr1165_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0612510076 | NA | 4.56E-06 | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |