Variant ID: vg0611702154 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 11702154 |
Reference Allele: T | Alternative Allele: G |
Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATACATATATATCACTTTTCAATAAATATTTTAATAGAAACAAGAAGTCAAAGTTGTGTTTTGGAGACCGTGTCGTTGTCCAAAACAACTTCCTTAACGA[T/G]
TACGGAGGGAGTACTCCATACTACTATCAATTGAATGCTGCTCAATTGATGCATCATTGCTTATTTAATTTGTCCATGGAACAAGCTATTTTTGTTTAAG
CTTAAACAAAAATAGCTTGTTCCATGGACAAATTAAATAAGCAATGATGCATCAATTGAGCAGCATTCAATTGATAGTAGTATGGAGTACTCCCTCCGTA[A/C]
TCGTTAAGGAAGTTGTTTTGGACAACGACACGGTCTCCAAAACACAACTTTGACTTCTTGTTTCTATTAAAATATTTATTGAAAAGTGATATATATGTAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.90% | 5.10% | 0.02% | 0.00% | NA |
All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 19.70% | 80.30% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0611702154 | T -> G | LOC_Os06g20370.1 | upstream_gene_variant ; 861.0bp to feature; MODIFIER | silent_mutation | Average:58.676; most accessible tissue: Zhenshan97 flower, score: 86.908 | N | N | N | N |
vg0611702154 | T -> G | LOC_Os06g20380.1 | downstream_gene_variant ; 2233.0bp to feature; MODIFIER | silent_mutation | Average:58.676; most accessible tissue: Zhenshan97 flower, score: 86.908 | N | N | N | N |
vg0611702154 | T -> G | LOC_Os06g20370-LOC_Os06g20380 | intergenic_region ; MODIFIER | silent_mutation | Average:58.676; most accessible tissue: Zhenshan97 flower, score: 86.908 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0611702154 | NA | 6.15E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 2.40E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 3.42E-32 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 2.43E-29 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 3.25E-30 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 9.16E-16 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 6.16E-19 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 4.84E-21 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 3.96E-18 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0611702154 | NA | 4.20E-23 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/