RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0611571279:

Variant ID: vg0611571279 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11571279
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCGACTTTGAGGTCGCCATGGACGGTGATGGGGCCACCGGGGCCCGGCATCTTCATCTGGATATAGGCGTACTGGACCGCCGCCATGAACTTCACCAAC[G/A]
CGGGCCTCCCCAGGACCGCGTTGTAGGGCAGACTGAGGTCCGCCACATCGAAGTCCACCCGCTCCGTGCGGAAGTTGGCGGAACCACCAAAGGTGACCGG

Reverse complement sequence

CCGGTCACCTTTGGTGGTTCCGCCAACTTCCGCACGGAGCGGGTGGACTTCGATGTGGCGGACCTCAGTCTGCCCTACAACGCGGTCCTGGGGAGGCCCG[C/T]
GTTGGTGAAGTTCATGGCGGCGGTCCAGTACGCCTATATCCAGATGAAGATGCCGGGCCCCGGTGGCCCCATCACCGTCCATGGCGACCTCAAAGTCGCG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.70%	1.20%	1.06%	60.03%	NA
All Indica	2759	6.60%	0.00%	1.01%	92.39%	NA
All Japonica	1512	88.00%	3.90%	1.26%	6.88%	NA
Aus	269	73.60%	0.00%	0.74%	25.65%	NA
Indica I	595	9.70%	0.00%	0.34%	89.92%	NA
Indica II	465	5.20%	0.00%	1.08%	93.76%	NA
Indica III	913	1.50%	0.00%	1.20%	97.26%	NA
Indica Intermediate	786	10.90%	0.00%	1.27%	87.79%	NA
Temperate Japonica	767	89.40%	6.00%	1.69%	2.87%	NA
Tropical Japonica	504	83.50%	0.60%	1.19%	14.68%	NA
Japonica Intermediate	241	92.50%	4.10%	0.00%	3.32%	NA
VI/Aromatic	96	31.20%	0.00%	0.00%	68.75%	NA
Intermediate	90	44.40%	0.00%	1.11%	54.44%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611571279	G -> A	LOC_Os06g20170.1	missense_variant ; p.Ala631Val; MODERATE	nonsynonymous_codon ; A631V	Average:7.922; most accessible tissue: Minghui63 panicle, score: 16.27	benign	0.491	DELETERIOUS	0.01
vg0611571279	G -> DEL	LOC_Os06g20170.1	N	frameshift_variant	Average:7.922; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611571279	NA	3.62E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0611571279	NA	1.26E-06	mr1179	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	2.31E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	7.86E-10	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	1.86E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	1.59E-08	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	1.52E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	5.05E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611571279	NA	7.49E-07	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0611571279:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact