Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611497725:

Variant ID: vg0611497725 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11497725
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

CGGTATGTTCCTCGTAAAATAGAAAAAACCGAGTTTAGTCCAAAAATTTATCTCGATGTTCCTAGCTTAATACATAGCTATCCTAGATAATTATGTCATG[G/A]
AGCACCATATAGGATGATTACGACATGCATGATAATAATGAGGAAACTGTCATCTAACCGACCACGTGACAAGGCTGACAAGGCTATTCAGATTATGCCA

Reverse complement sequence

TGGCATAATCTGAATAGCCTTGTCAGCCTTGTCACGTGGTCGGTTAGATGACAGTTTCCTCATTATTATCATGCATGTCGTAATCATCCTATATGGTGCT[C/T]
CATGACATAATTATCTAGGATAGCTATGTATTAAGCTAGGAACATCGAGATAAATTTTTGGACTAAACTCGGTTTTTTCTATTTTACGAGGAACATACCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.30%	0.57%	0.13%	NA
All Indica	2759	56.90%	42.10%	0.72%	0.22%	NA
All Japonica	1512	90.10%	9.90%	0.07%	0.00%	NA
Aus	269	73.20%	26.40%	0.37%	0.00%	NA
Indica I	595	73.80%	25.90%	0.34%	0.00%	NA
Indica II	465	78.50%	21.30%	0.22%	0.00%	NA
Indica III	913	35.60%	62.30%	1.53%	0.55%	NA
Indica Intermediate	786	56.20%	43.30%	0.38%	0.13%	NA
Temperate Japonica	767	97.00%	3.00%	0.00%	0.00%	NA
Tropical Japonica	504	76.40%	23.40%	0.20%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	64.60%	3.12%	0.00%	NA
Intermediate	90	57.80%	40.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611497725	G -> A	LOC_Os06g20040.1	upstream_gene_variant ; 3455.0bp to feature; MODIFIER	silent_mutation	Average:59.297; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0611497725	G -> A	LOC_Os06g20050.1	upstream_gene_variant ; 1267.0bp to feature; MODIFIER	silent_mutation	Average:59.297; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0611497725	G -> A	LOC_Os06g20040-LOC_Os06g20050	intergenic_region ; MODIFIER	silent_mutation	Average:59.297; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N
vg0611497725	G -> DEL	N	N	silent_mutation	Average:59.297; most accessible tissue: Minghui63 root, score: 69.846	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611497725	NA	4.18E-08	mr1218	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611497725	NA	1.32E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611497725	7.58E-07	7.53E-07	mr1197_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611497725	NA	6.44E-09	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251