Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611427499:

Variant ID: vg0611427499 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11427499
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCAGTAACATATTTATACATATATATACTCGTATGCTGCTAGCTCATCCACACTTCACGACATGACTTCTTATTTTATTTGACTTGGCCACACCTCCA[G/C]
CAAACGTTGACGTGCACTAGTGCACCTTACAGCTGTATGTAGGTCATGGCAATCACCAATCCAACGAATTCGGATCATGTGCAATGAATGCAAGTTACGC

Reverse complement sequence

GCGTAACTTGCATTCATTGCACATGATCCGAATTCGTTGGATTGGTGATTGCCATGACCTACATACAGCTGTAAGGTGCACTAGTGCACGTCAACGTTTG[C/G]
TGGAGGTGTGGCCAAGTCAAATAAAATAAGAAGTCATGTCGTGAAGTGTGGATGAGCTAGCAGCATACGAGTATATATATGTATAAATATGTTACTGGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.40% 37.20% 0.36% 12.97% NA
All Indica  2759 78.60% 3.60% 0.33% 17.51% NA
All Japonica  1512 3.20% 88.40% 0.46% 7.87% NA
Aus  269 26.00% 74.00% 0.00% 0.00% NA
Indica I  595 92.10% 6.40% 0.17% 1.34% NA
Indica II  465 95.10% 2.20% 0.22% 2.58% NA
Indica III  913 61.70% 1.20% 0.33% 36.80% NA
Indica Intermediate  786 78.20% 5.10% 0.51% 16.16% NA
Temperate Japonica  767 4.00% 95.70% 0.13% 0.13% NA
Tropical Japonica  504 1.20% 75.40% 0.79% 22.62% NA
Japonica Intermediate  241 5.00% 92.50% 0.83% 1.66% NA
VI/Aromatic  96 11.50% 84.40% 0.00% 4.17% NA
Intermediate  90 43.30% 47.80% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611427499 G -> C LOC_Os06g19950.1 downstream_gene_variant ; 2564.0bp to feature; MODIFIER silent_mutation Average:85.426; most accessible tissue: Callus, score: 99.71 N N N N
vg0611427499 G -> C LOC_Os06g19950-LOC_Os06g19960 intergenic_region ; MODIFIER silent_mutation Average:85.426; most accessible tissue: Callus, score: 99.71 N N N N
vg0611427499 G -> DEL N N silent_mutation Average:85.426; most accessible tissue: Callus, score: 99.71 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0611427499 G C -0.03 0.03 0.02 0.01 0.06 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611427499 2.19E-06 4.56E-07 mr1020 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 7.54E-08 7.54E-08 mr1032 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 4.43E-06 3.02E-59 mr1065 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.08E-56 mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 5.29E-59 mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 6.33E-58 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 2.55E-48 mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.30E-44 mr1112 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 3.90E-49 mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.99E-45 mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 3.37E-06 NA mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 2.24E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 4.72E-08 4.72E-08 mr1165 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 4.16E-46 mr1200 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.02E-53 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 7.65E-30 mr1237 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 4.54E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 1.04E-09 1.04E-09 mr1478 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.44E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 7.27E-06 mr1780 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 4.58E-07 1.30E-08 mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 3.49E-62 mr1065_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.98E-68 mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 3.15E-65 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.85E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 9.66E-54 mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 4.02E-06 3.52E-08 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 4.87E-53 mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 1.54E-11 3.95E-14 mr1165_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.45E-34 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 5.07E-56 mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 1.96E-61 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 4.52E-08 4.52E-08 mr1477_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 7.76E-07 7.76E-07 mr1478_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 NA 3.08E-58 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611427499 4.24E-11 4.24E-11 mr1971_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251