Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611210886:

Variant ID: vg0611210886 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 11210886
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, T: 0.41, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCTACTTTAATAGATTTATCAAACTGCGCCATCTATGCGCCACACATTCCTTTTGCATACCGAACCAAGATGAAATAGATGACGTTGTGTTTTTTTTT[A/T]
AAATTTGCTTCCACTGTTGGCTTGTAGCTTTGTTCAGTATGCCTGAATGGGACTAATTTTCTACTTTCTAGGTTCCTCGCATCCAAAATGAGCTTGTATC

Reverse complement sequence

GATACAAGCTCATTTTGGATGCGAGGAACCTAGAAAGTAGAAAATTAGTCCCATTCAGGCATACTGAACAAAGCTACAAGCCAACAGTGGAAGCAAATTT[T/A]
AAAAAAAAACACAACGTCATCTATTTCATCTTGGTTCGGTATGCAAAAGGAATGTGTGGCGCATAGATGGCGCAGTTTGATAAATCTATTAAAGTAGACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.10% 10.90% 0.02% 0.00% NA
All Indica  2759 84.50% 15.50% 0.04% 0.00% NA
All Japonica  1512 94.80% 5.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 87.50% 12.50% 0.00% 0.00% NA
Indica III  913 79.10% 20.90% 0.00% 0.00% NA
Indica Intermediate  786 80.40% 19.50% 0.13% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 87.70% 12.30% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0611210886 A -> T LOC_Os06g19640.1 upstream_gene_variant ; 2807.0bp to feature; MODIFIER silent_mutation Average:44.982; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0611210886 A -> T LOC_Os06g19650.1 intron_variant ; MODIFIER silent_mutation Average:44.982; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0611210886 NA 4.02E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611210886 2.48E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611210886 3.69E-06 9.53E-07 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611210886 5.49E-07 2.51E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611210886 NA 2.30E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611210886 NA 6.75E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611210886 3.29E-06 9.96E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251