Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611197335:

Variant ID: vg0611197335 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11197335
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGCCGGTTGTGAGTGGTTTGGAGTTCACCACCTTCGGAGTGAAGGAAGAACTACCCTTGTGATCGAGGCTTGGGTAGTCCTCTCCATGGGCCGGCTCC[C/T]
ACCTTACCCACCCCTTGATGAAGGGGGCGTGCGGTGGCTTCGTGGTTGAGCGGTGGAGTTGGGCTCGCCTCAACGGGGATTAGGAAACCGGCGAGTTTCC

Reverse complement sequence

GGAAACTCGCCGGTTTCCTAATCCCCGTTGAGGCGAGCCCAACTCCACCGCTCAACCACGAAGCCACCGCACGCCCCCTTCATCAAGGGGTGGGTAAGGT[G/A]
GGAGCCGGCCCATGGAGAGGACTACCCAAGCCTCGATCACAAGGGTAGTTCTTCCTTCACTCCGAAGGTGGTGAACTCCAAACCACTCACAACCGGCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	2.50%	4.87%	17.48%	NA
All Indica	2759	59.10%	4.30%	8.08%	28.49%	NA
All Japonica	1512	98.10%	0.00%	0.07%	1.85%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	22.00%	10.10%	9.92%	57.98%	NA
Indica II	465	90.50%	0.60%	3.23%	5.59%	NA
Indica III	913	68.80%	2.70%	8.87%	19.61%	NA
Indica Intermediate	786	57.40%	3.90%	8.65%	30.03%	NA
Temperate Japonica	767	97.70%	0.00%	0.13%	2.22%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	96.70%	0.00%	0.00%	3.32%	NA
VI/Aromatic	96	92.70%	0.00%	2.08%	5.21%	NA
Intermediate	90	86.70%	1.10%	4.44%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611197335	C -> T	LOC_Os06g19630.2	downstream_gene_variant ; 2797.0bp to feature; MODIFIER	silent_mutation	Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0611197335	C -> T	LOC_Os06g19630.1	downstream_gene_variant ; 2797.0bp to feature; MODIFIER	silent_mutation	Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0611197335	C -> T	LOC_Os06g19620-LOC_Os06g19630	intergenic_region ; MODIFIER	silent_mutation	Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N
vg0611197335	C -> DEL	N	N	silent_mutation	Average:32.276; most accessible tissue: Minghui63 flag leaf, score: 54.348	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611197335	NA	2.58E-09	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335	NA	9.69E-10	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335	NA	1.76E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335	5.63E-06	5.63E-06	mr1544	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335	4.88E-08	2.18E-07	mr1547	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335	NA	3.99E-07	mr1743	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611197335	NA	9.40E-08	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251