Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611136921:

Variant ID: vg0611136921 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11136921
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTATATCATTGGGTTTTCTAAATTGAAAATAGAAAGAGAAAAACTTCTTTCTATAAGTGAAAGCCTAAATTTAATCCTTAAAAACTAAAAATGGACCCT[C/T]
TTATTGAACAACCAACCAAATATTTGTTTTTCCACTGACCCGTGTAAAAAAAATATCGCTTCTCCAAGTGCGCGATCTTCTCTCCCCGTGTACAAAGAGA

Reverse complement sequence

TCTCTTTGTACACGGGGAGAGAAGATCGCGCACTTGGAGAAGCGATATTTTTTTTACACGGGTCAGTGGAAAAACAAATATTTGGTTGGTTGTTCAATAA[G/A]
AGGGTCCATTTTTAGTTTTTAAGGATTAAATTTAGGCTTTCACTTATAGAAAGAAGTTTTTCTCTTTCTATTTTCAATTTAGAAAACCCAATGATATAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	8.80%	0.23%	23.30%	NA
All Indica	2759	61.10%	0.20%	0.36%	38.31%	NA
All Japonica	1512	71.50%	26.70%	0.07%	1.79%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	27.40%	0.30%	0.34%	71.93%	NA
Indica II	465	92.90%	0.00%	0.22%	6.88%	NA
Indica III	913	70.60%	0.00%	0.22%	29.13%	NA
Indica Intermediate	786	56.90%	0.40%	0.64%	42.11%	NA
Temperate Japonica	767	53.80%	43.90%	0.13%	2.09%	NA
Tropical Japonica	504	96.60%	2.80%	0.00%	0.60%	NA
Japonica Intermediate	241	75.10%	21.60%	0.00%	3.32%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	83.30%	5.60%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611136921	C -> T	LOC_Os06g19550.1	upstream_gene_variant ; 2271.0bp to feature; MODIFIER	silent_mutation	Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0611136921	C -> T	LOC_Os06g19550.2	upstream_gene_variant ; 2271.0bp to feature; MODIFIER	silent_mutation	Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0611136921	C -> T	LOC_Os06g19550-LOC_Os06g19570	intergenic_region ; MODIFIER	silent_mutation	Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0611136921	C -> DEL	N	N	silent_mutation	Average:27.338; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611136921	NA	2.30E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	2.31E-06	1.82E-10	mr1570	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	NA	1.61E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	NA	5.88E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	NA	4.28E-07	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	NA	4.17E-11	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	NA	7.68E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611136921	NA	5.08E-06	mr1928_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251