Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0611066801:

Variant ID: vg0611066801 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 11066801
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.58, G: 0.42, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TATCTCACATGATGTCTTGGATGTTGTGTAGAAACCATGTCTCATGCAAGACATGGTTTCCTTTTCTTTCCTCATTTATTCACTTGTCACATTATTTTTT[T/G]
TCATAGGTGGCAACTTATTTAATGTTATGGACACCATTCTAGTCATTGGGTTGGGAATGTCCTTATATTATGGAATAGAGGGAGTACTATTTGTTCGTGA

Reverse complement sequence

TCACGAACAAATAGTACTCCCTCTATTCCATAATATAAGGACATTCCCAACCCAATGACTAGAATGGTGTCCATAACATTAAATAAGTTGCCACCTATGA[A/C]
AAAAAATAATGTGACAAGTGAATAAATGAGGAAAGAAAAGGAAACCATGTCTTGCATGAGACATGGTTTCTACACAACATCCAAGACATCATGTGAGATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.80%	2.30%	4.61%	56.33%	NA
All Indica	2759	2.60%	3.80%	6.16%	87.46%	NA
All Japonica	1512	88.40%	0.10%	0.26%	11.31%	NA
Aus	269	77.30%	0.00%	15.24%	7.43%	NA
Indica I	595	1.50%	0.50%	2.35%	95.63%	NA
Indica II	465	1.90%	0.40%	3.01%	94.62%	NA
Indica III	913	1.30%	7.10%	10.08%	81.49%	NA
Indica Intermediate	786	5.30%	4.30%	6.36%	83.97%	NA
Temperate Japonica	767	95.70%	0.00%	0.13%	4.17%	NA
Tropical Japonica	504	75.20%	0.00%	0.40%	24.40%	NA
Japonica Intermediate	241	92.50%	0.40%	0.41%	6.64%	NA
VI/Aromatic	96	86.50%	1.00%	2.08%	10.42%	NA
Intermediate	90	44.40%	1.10%	1.11%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0611066801	T -> G	LOC_Os06g19410.1	upstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0611066801	T -> G	LOC_Os06g19420.1	upstream_gene_variant ; 1661.0bp to feature; MODIFIER	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0611066801	T -> G	LOC_Os06g19430.1	downstream_gene_variant ; 2024.0bp to feature; MODIFIER	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0611066801	T -> G	LOC_Os06g19444.1	downstream_gene_variant ; 3327.0bp to feature; MODIFIER	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0611066801	T -> G	LOC_Os06g19444.2	downstream_gene_variant ; 3307.0bp to feature; MODIFIER	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0611066801	T -> G	LOC_Os06g19420-LOC_Os06g19430	intergenic_region ; MODIFIER	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0611066801	T -> DEL	N	N	silent_mutation	Average:43.764; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0611066801	8.46E-06	1.45E-07	mr1020	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	5.01E-08	5.01E-08	mr1032	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	3.68E-08	3.68E-08	mr1165	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	1.42E-09	1.42E-09	mr1478	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	NA	6.85E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	NA	8.43E-06	mr1857	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	1.29E-06	3.22E-09	mr1971	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	3.95E-17	1.89E-19	mr1165_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	NA	7.27E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	2.81E-09	2.81E-09	mr1477_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	NA	3.21E-06	mr1629_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	NA	5.89E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	NA	4.59E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0611066801	1.02E-10	1.02E-10	mr1971_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251