Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610752419:

Variant ID: vg0610752419 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10752419
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.10, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAAAACCCAAAAACTTTTAGCGGAAATAAAAGTTACCCTCAAATCGATGGAAATCTCAACGTAGTCCTGTCGCCGCCGGTCGGACCGCTTGCACGCCG[C/T]
CGGTCGGACCGCTCGCACGCCGCCGGAACCCGAAGAAACACAAATCGAAGAACTCTCAAAGTAGATAACAACTTTATTGCTTCTCTCTGTGTTTACAAAG

Reverse complement sequence

CTTTGTAAACACAGAGAGAAGCAATAAAGTTGTTATCTACTTTGAGAGTTCTTCGATTTGTGTTTCTTCGGGTTCCGGCGGCGTGCGAGCGGTCCGACCG[G/A]
CGGCGTGCAAGCGGTCCGACCGGCGGCGACAGGACTACGTTGAGATTTCCATCGATTTGAGGGTAACTTTTATTTCCGCTAAAAGTTTTTGGGTTTTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.70% 0.00% 0.00% NA
All Indica  2759 86.80% 13.20% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 75.50% 24.50% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610752419 C -> T LOC_Os06g18930.1 upstream_gene_variant ; 3955.0bp to feature; MODIFIER silent_mutation Average:34.464; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0610752419 C -> T LOC_Os06g18920.1 downstream_gene_variant ; 2709.0bp to feature; MODIFIER silent_mutation Average:34.464; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0610752419 C -> T LOC_Os06g18920-LOC_Os06g18930 intergenic_region ; MODIFIER silent_mutation Average:34.464; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610752419 1.57E-06 NA mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 6.22E-06 3.29E-10 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 3.98E-06 7.80E-11 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 2.46E-07 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 5.32E-06 NA mr1091 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 4.39E-08 1.07E-10 mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 2.30E-06 9.28E-08 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 2.19E-07 7.48E-10 mr1096 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 6.64E-08 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 2.27E-08 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 1.20E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 1.11E-06 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 8.06E-06 8.65E-08 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 3.13E-06 mr1218 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 4.43E-10 4.34E-12 mr1065_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 9.69E-09 4.81E-13 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 9.43E-10 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 7.60E-08 8.34E-14 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 2.13E-07 2.72E-12 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 2.64E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 1.60E-09 4.61E-12 mr1091_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 2.60E-07 1.75E-09 mr1094_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 1.33E-08 3.92E-12 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 4.20E-07 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 5.64E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 7.00E-07 7.46E-11 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 2.24E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 6.58E-07 2.87E-09 mr1112_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 1.40E-06 1.30E-09 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 2.63E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 5.79E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 1.23E-06 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 5.84E-08 NA mr1234_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610752419 NA 2.29E-09 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251