Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610733548:

Variant ID: vg0610733548 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10733548
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGACCCCCCGCGCGAACCGACCTCGCCTCCACTATAAAGCCGAGTCCCTCCTCTCAATCCCTCCCGCTTCAGTCTCCACTGCTGCCGCGCCATTGTTGC[C/T]
GCCCTTGCCGTGCAGTTGCCCTCGCCGTCCGTCGCCGAAGCACCAGGGAGACCGGTGCGTGCGAGGACGCGAGACGAGGACTACGGACACCCCTCTTCTT

Reverse complement sequence

AAGAAGAGGGGTGTCCGTAGTCCTCGTCTCGCGTCCTCGCACGCACCGGTCTCCCTGGTGCTTCGGCGACGGACGGCGAGGGCAACTGCACGGCAAGGGC[G/A]
GCAACAATGGCGCGGCAGCAGTGGAGACTGAAGCGGGAGGGATTGAGAGGAGGGACTCGGCTTTATAGTGGAGGCGAGGTCGGTTCGCGCGGGGGGTCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 4.90% 0.51% 0.91% NA
All Indica  2759 93.50% 5.30% 0.25% 1.01% NA
All Japonica  1512 93.50% 5.00% 0.79% 0.73% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 87.40% 11.80% 0.34% 0.50% NA
Indica II  465 95.10% 0.20% 0.65% 4.09% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 93.50% 5.50% 0.25% 0.76% NA
Temperate Japonica  767 99.20% 0.00% 0.26% 0.52% NA
Tropical Japonica  504 83.50% 14.10% 1.39% 0.99% NA
Japonica Intermediate  241 96.30% 1.70% 1.24% 0.83% NA
VI/Aromatic  96 93.80% 0.00% 3.12% 3.12% NA
Intermediate  90 86.70% 11.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610733548 C -> T LOC_Os06g18880.1 upstream_gene_variant ; 4060.0bp to feature; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0610733548 C -> T LOC_Os06g18890.1 downstream_gene_variant ; 2060.0bp to feature; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0610733548 C -> T LOC_Os06g18890-LOC_Os06g18900 intergenic_region ; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N
vg0610733548 C -> DEL N N silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 86.698 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610733548 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610733548 7.38E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 NA 6.26E-07 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 1.29E-12 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 3.66E-07 1.16E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 4.05E-09 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 9.28E-06 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 NA 4.17E-06 mr1128 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 1.46E-07 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 8.17E-18 NA mr1211 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 4.42E-10 3.17E-11 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 2.15E-08 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 9.42E-12 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 3.09E-06 7.67E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 6.91E-07 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 NA 1.16E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 5.69E-06 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 5.11E-16 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610733548 8.52E-09 2.90E-11 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251