Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610640647:

Variant ID: vg0610640647 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 10640647
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTAAAACCTTGATCAAATGTATGCAATGAAGATCCAGATCGTTGAACCTGTATCAATCTACTGATCCAGGTCTTGATACAGTCTAAACATGTCGGTTT[T/C]
CGAATCATTAGTTTTGGGACCCGACAATAAAGCACTGTCAAGTAGACTTGGAGGAATTCTTCTGGGTCGGTGCTCCCATCATACTTTTCAATAGCTCCGG

Reverse complement sequence

CCGGAGCTATTGAAAAGTATGATGGGAGCACCGACCCAGAAGAATTCCTCCAAGTCTACTTGACAGTGCTTTATTGTCGGGTCCCAAAACTAATGATTCG[A/G]
AAACCGACATGTTTAGACTGTATCAAGACCTGGATCAGTAGATTGATACAGGTTCAACGATCTGGATCTTCATTGCATACATTTGATCAAGGTTTTAAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.50%	11.20%	1.25%	54.04%	NA
All Indica	2759	13.70%	5.50%	1.88%	78.87%	NA
All Japonica	1512	57.90%	24.30%	0.00%	17.86%	NA
Aus	269	81.80%	0.70%	1.49%	15.99%	NA
Indica I	595	9.90%	7.20%	1.01%	81.85%	NA
Indica II	465	2.20%	2.20%	2.58%	93.12%	NA
Indica III	913	19.80%	5.00%	0.88%	74.26%	NA
Indica Intermediate	786	16.30%	6.90%	3.31%	73.54%	NA
Temperate Japonica	767	44.30%	43.20%	0.00%	12.52%	NA
Tropical Japonica	504	70.00%	0.40%	0.00%	29.56%	NA
Japonica Intermediate	241	75.50%	14.10%	0.00%	10.37%	NA
VI/Aromatic	96	86.50%	0.00%	3.12%	10.42%	NA
Intermediate	90	30.00%	8.90%	0.00%	61.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0610640647	T -> C	LOC_Os06g18770.1	downstream_gene_variant ; 676.0bp to feature; MODIFIER	silent_mutation	Average:6.196; most accessible tissue: Callus, score: 17.339	N	N	N	N
vg0610640647	T -> C	LOC_Os06g18750-LOC_Os06g18770	intergenic_region ; MODIFIER	silent_mutation	Average:6.196; most accessible tissue: Callus, score: 17.339	N	N	N	N
vg0610640647	T -> DEL	N	N	silent_mutation	Average:6.196; most accessible tissue: Callus, score: 17.339	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0610640647	2.31E-06	NA	mr1087	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640647	1.66E-06	2.35E-09	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640647	1.37E-06	NA	mr1241	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610640647	5.00E-06	9.81E-11	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251