| Variant ID: vg0610495466 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10495466 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATAATGTTATTTTGTCTAGTTTGGTTACCTTTTAATTTTGGTTGGTGTGTTTGCTTTCTTTTGGTCTGCACTCTTACAGAGTGCTAGTTTGTAATAATTG[C/G]
CTGTAGCTCTTTTGAGCAAAGGCCGGGATGTTATTTTATTCCATTATCTAAAAAAAGAAAAATGTTCTAGCATCCTAGTTTTTTCTTTTCTCTTTTCTCT
AGAGAAAAGAGAAAAGAAAAAACTAGGATGCTAGAACATTTTTCTTTTTTTAGATAATGGAATAAAATAACATCCCGGCCTTTGCTCAAAAGAGCTACAG[G/C]
CAATTATTACAAACTAGCACTCTGTAAGAGTGCAGACCAAAAGAAAGCAAACACACCAACCAAAATTAAAAGGTAACCAAACTAGACAAAATAACATTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.10% | 11.70% | 6.20% | 23.91% | NA |
| All Indica | 2759 | 73.40% | 6.90% | 6.85% | 12.90% | NA |
| All Japonica | 1512 | 39.90% | 15.10% | 3.77% | 41.20% | NA |
| Aus | 269 | 19.30% | 39.00% | 14.87% | 26.77% | NA |
| Indica I | 595 | 93.60% | 0.50% | 1.18% | 4.71% | NA |
| Indica II | 465 | 90.80% | 1.50% | 4.30% | 3.44% | NA |
| Indica III | 913 | 56.10% | 11.40% | 12.71% | 19.82% | NA |
| Indica Intermediate | 786 | 67.80% | 9.70% | 5.85% | 16.67% | NA |
| Temperate Japonica | 767 | 55.00% | 3.90% | 1.83% | 39.24% | NA |
| Tropical Japonica | 504 | 24.60% | 32.90% | 6.15% | 36.31% | NA |
| Japonica Intermediate | 241 | 24.10% | 13.30% | 4.98% | 57.68% | NA |
| VI/Aromatic | 96 | 10.40% | 19.80% | 3.12% | 66.67% | NA |
| Intermediate | 90 | 64.40% | 14.40% | 4.44% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610495466 | C -> G | LOC_Os06g18030.1 | upstream_gene_variant ; 2737.0bp to feature; MODIFIER | silent_mutation | Average:31.97; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0610495466 | C -> G | LOC_Os06g18020-LOC_Os06g18030 | intergenic_region ; MODIFIER | silent_mutation | Average:31.97; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0610495466 | C -> DEL | N | N | silent_mutation | Average:31.97; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610495466 | 2.39E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | 5.02E-06 | 3.29E-10 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | 5.07E-06 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | NA | 3.34E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | 2.47E-07 | NA | mr1090 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | NA | 1.96E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | NA | 2.60E-07 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | NA | 6.90E-07 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | NA | 6.35E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610495466 | NA | 9.79E-09 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/