Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610455705:

Variant ID: vg0610455705 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10455705
Reference Allele: GAlternative Allele: C,GC
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGAGTAATATTTTGCTGTTATTTCAGTGATTAAAAACGAAAATTTTAAAGAAAACATTGAATGCAATTAGATCTGCCCAGGTTCTCAAAATTTCTTTAG[G/C,GC]
TCCGCCACTGCTTGAATCGATATGTCATATGCTGCAAATTAAGTGGATTGGAGATATACATGCGCTCGAATGTTCTCGGTTATATTGTAATTGTGGAGTA

Reverse complement sequence

TACTCCACAATTACAATATAACCGAGAACATTCGAGCGCATGTATATCTCCAATCCACTTAATTTGCAGCATATGACATATCGATTCAAGCAGTGGCGGA[C/G,GC]
CTAAAGAAATTTTGAGAACCTGGGCAGATCTAATTGCATTCAATGTTTTCTTTAAAATTTTCGTTTTTAATCACTGAAATAACAGCAAAATATTACTCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 37.20% 1.63% 4.21% NA
All Indica  2759 85.50% 7.60% 2.39% 4.46% NA
All Japonica  1512 14.20% 80.90% 0.66% 4.30% NA
Aus  269 16.70% 82.90% 0.37% 0.00% NA
Indica I  595 91.80% 8.10% 0.17% 0.00% NA
Indica II  465 89.90% 2.80% 2.37% 4.95% NA
Indica III  913 80.90% 7.20% 3.40% 8.43% NA
Indica Intermediate  786 83.60% 10.60% 2.93% 2.93% NA
Temperate Japonica  767 5.10% 92.40% 0.91% 1.56% NA
Tropical Japonica  504 30.60% 67.70% 0.00% 1.79% NA
Japonica Intermediate  241 8.70% 71.80% 1.24% 18.26% NA
VI/Aromatic  96 14.60% 77.10% 0.00% 8.33% NA
Intermediate  90 64.40% 32.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610455705 G -> C LOC_Os06g17980.1 upstream_gene_variant ; 461.0bp to feature; MODIFIER silent_mutation Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N
vg0610455705 G -> C LOC_Os06g17970.1 downstream_gene_variant ; 4553.0bp to feature; MODIFIER silent_mutation Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N
vg0610455705 G -> C LOC_Os06g17980-LOC_Os06g17990 intergenic_region ; MODIFIER silent_mutation Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N
vg0610455705 G -> DEL N N silent_mutation Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N
vg0610455705 G -> GC LOC_Os06g17980.1 upstream_gene_variant ; 462.0bp to feature; MODIFIER N Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N
vg0610455705 G -> GC LOC_Os06g17970.1 downstream_gene_variant ; 4554.0bp to feature; MODIFIER N Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N
vg0610455705 G -> GC LOC_Os06g17980-LOC_Os06g17990 intergenic_region ; MODIFIER N Average:82.36; most accessible tissue: Zhenshan97 flower, score: 89.027 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0610455705 G C -0.01 -0.02 0.0 -0.03 -0.02 -0.01
vg0610455705 G GC 0.1 0.04 0.08 0.09 0.13 0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610455705 4.04E-11 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 3.67E-08 1.89E-11 mr1087 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 NA 7.27E-07 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 1.15E-14 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 2.93E-12 4.46E-20 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 1.35E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 NA 4.01E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 8.36E-06 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610455705 7.48E-06 7.47E-06 mr1474_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251