| Variant ID: vg0610446203 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10446203 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCAAGGTTGCTTCGGTTGCCGCAGAAAAGATGGTCTTGCTGCTGGGAGTGCAGAAGGAGATATGGTGAGCATCTGAATTGCAGCCTAATTAATTTTATTT[G/C,T]
TCATTTGCATTAGATTTATTGGGACCACACTTATGCAGAGTGGTATGGTACTCAGTTTATTTTTAATGATTTATTTATATTTTTTATTACATATCCTGGA
TCCAGGATATGTAATAAAAAATATAAATAAATCATTAAAAATAAACTGAGTACCATACCACTCTGCATAAGTGTGGTCCCAATAAATCTAATGCAAATGA[C/G,A]
AAATAAAATTAATTAGGCTGCAATTCAGATGCTCACCATATCTCCTTCTGCACTCCCAGCAGCAAGACCATCTTTTCTGCGGCAACCGAAGCAACCTTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.60% | 21.60% | 5.16% | 47.27% | T: 0.36% |
| All Indica | 2759 | 7.40% | 12.70% | 6.31% | 73.21% | T: 0.40% |
| All Japonica | 1512 | 45.30% | 42.00% | 4.23% | 8.07% | T: 0.40% |
| Aus | 269 | 82.20% | 1.90% | 1.49% | 14.50% | NA |
| Indica I | 595 | 8.40% | 12.90% | 2.18% | 76.13% | T: 0.34% |
| Indica II | 465 | 1.50% | 4.10% | 4.95% | 89.25% | T: 0.22% |
| Indica III | 913 | 6.50% | 15.40% | 8.00% | 69.55% | T: 0.55% |
| Indica Intermediate | 786 | 11.20% | 14.40% | 8.27% | 65.78% | T: 0.38% |
| Temperate Japonica | 767 | 42.50% | 46.50% | 4.69% | 5.61% | T: 0.65% |
| Tropical Japonica | 504 | 46.80% | 42.70% | 2.78% | 7.74% | NA |
| Japonica Intermediate | 241 | 51.00% | 26.10% | 5.81% | 16.60% | T: 0.41% |
| VI/Aromatic | 96 | 78.10% | 7.30% | 0.00% | 14.58% | NA |
| Intermediate | 90 | 26.70% | 27.80% | 2.22% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610446203 | G -> C | LOC_Os06g17960.1 | upstream_gene_variant ; 3156.0bp to feature; MODIFIER | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| vg0610446203 | G -> C | LOC_Os06g17950.1 | downstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| vg0610446203 | G -> C | LOC_Os06g17970.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| vg0610446203 | G -> T | LOC_Os06g17960.1 | upstream_gene_variant ; 3156.0bp to feature; MODIFIER | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| vg0610446203 | G -> T | LOC_Os06g17950.1 | downstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| vg0610446203 | G -> T | LOC_Os06g17970.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| vg0610446203 | G -> DEL | N | N | silent_mutation | Average:14.925; most accessible tissue: Callus, score: 88.215 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610446203 | NA | 3.02E-10 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 1.60E-12 | NA | mr1068 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 5.35E-11 | 4.52E-21 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 5.88E-08 | NA | mr1078 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 1.15E-09 | 1.47E-13 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 5.90E-07 | 2.71E-13 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 4.03E-07 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 2.57E-06 | 1.39E-15 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 3.58E-06 | 3.56E-12 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610446203 | 1.98E-06 | 6.88E-14 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/