| Variant ID: vg0610442278 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 10442278 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.32, others allele: 0.00, population size: 86. )
ATTGTTAGATCTAGCGTGAGGTATCGGTATCTCAAGGACTCGATGTACTTTTTGTTAGACCGGAGCATATCTTTAAAAATTTAATGTAAAATTCGGTACT[G/A]
AGAGGTACCAAAATTACATTAGAAAAGTGCTACTTCCTATTAGCTTCTCAAGAACTGTAAAATTGTTCTTTTAATCTTAATCTTGGAGTACTAGGATGGT
ACCATCCTAGTACTCCAAGATTAAGATTAAAAGAACAATTTTACAGTTCTTGAGAAGCTAATAGGAAGTAGCACTTTTCTAATGTAATTTTGGTACCTCT[C/T]
AGTACCGAATTTTACATTAAATTTTTAAAGATATGCTCCGGTCTAACAAAAAGTACATCGAGTCCTTGAGATACCGATACCTCACGCTAGATCTAACAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 14.30% | 1.02% | 34.74% | NA |
| All Indica | 2759 | 22.40% | 19.50% | 1.63% | 56.54% | NA |
| All Japonica | 1512 | 91.30% | 7.70% | 0.00% | 1.06% | NA |
| Aus | 269 | 83.60% | 2.60% | 0.00% | 13.75% | NA |
| Indica I | 595 | 21.70% | 3.90% | 2.69% | 71.76% | NA |
| Indica II | 465 | 5.80% | 10.80% | 2.15% | 81.29% | NA |
| Indica III | 913 | 23.90% | 32.70% | 0.55% | 42.83% | NA |
| Indica Intermediate | 786 | 30.90% | 21.00% | 1.78% | 46.31% | NA |
| Temperate Japonica | 767 | 85.10% | 13.70% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 99.00% | 0.60% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.60% | 3.30% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 87.50% | 8.30% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 62.20% | 6.70% | 3.33% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0610442278 | G -> A | LOC_Os06g17970.1 | upstream_gene_variant ; 2774.0bp to feature; MODIFIER | silent_mutation | Average:12.406; most accessible tissue: Callus, score: 75.299 | N | N | N | N |
| vg0610442278 | G -> A | LOC_Os06g17950.1 | downstream_gene_variant ; 371.0bp to feature; MODIFIER | silent_mutation | Average:12.406; most accessible tissue: Callus, score: 75.299 | N | N | N | N |
| vg0610442278 | G -> A | LOC_Os06g17960.1 | downstream_gene_variant ; 359.0bp to feature; MODIFIER | silent_mutation | Average:12.406; most accessible tissue: Callus, score: 75.299 | N | N | N | N |
| vg0610442278 | G -> A | LOC_Os06g17950-LOC_Os06g17960 | intergenic_region ; MODIFIER | silent_mutation | Average:12.406; most accessible tissue: Callus, score: 75.299 | N | N | N | N |
| vg0610442278 | G -> DEL | N | N | silent_mutation | Average:12.406; most accessible tissue: Callus, score: 75.299 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0610442278 | 6.64E-09 | NA | mr1065 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 1.23E-15 | 6.11E-20 | mr1065 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 8.71E-09 | 5.96E-11 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 2.36E-14 | NA | mr1068 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 5.24E-22 | 3.09E-24 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 4.22E-07 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 3.09E-13 | 5.49E-17 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 1.04E-11 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 6.69E-21 | 7.82E-27 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0610442278 | 1.28E-11 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/