Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610110374:

Variant ID: vg0610110374 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10110374
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCAATTTTCCACTCTTCTCCCAAACCGGAATTGCTAAAAATATGTCGACAATTTTTTGACTGATTTCAGTCGGCGTTGCTGGCCGTACGATTTCTCCG[C/T]
GAGTATTCGGCTGTGAATCTTTCAATCGTTGGATTTTTTTCACGCGTTGCGGCAAGCTAGCCCCAATCTTCGTTGCTGATTAGCGTTTAATATTGCACTG

Reverse complement sequence

CAGTGCAATATTAAACGCTAATCAGCAACGAAGATTGGGGCTAGCTTGCCGCAACGCGTGAAAAAAATCCAACGATTGAAAGATTCACAGCCGAATACTC[G/A]
CGGAGAAATCGTACGGCCAGCAACGCCGACTGAAATCAGTCAAAAAATTGTCGACATATTTTTAGCAATTCCGGTTTGGGAGAAGAGTGGAAAATTGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.04% 0.00% NA
All Indica  2759 92.70% 7.30% 0.04% 0.00% NA
All Japonica  1512 89.00% 11.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.90% 13.10% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 94.00% 6.00% 0.00% 0.00% NA
Indica Intermediate  786 92.50% 7.50% 0.00% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 74.60% 25.40% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610110374 C -> T LOC_Os06g17430.1 downstream_gene_variant ; 1715.0bp to feature; MODIFIER silent_mutation Average:42.868; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0610110374 C -> T LOC_Os06g17430-LOC_Os06g17440 intergenic_region ; MODIFIER silent_mutation Average:42.868; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610110374 2.60E-09 2.60E-09 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 2.16E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 9.32E-06 7.35E-07 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 6.22E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 7.54E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 2.10E-08 1.91E-10 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 1.85E-06 1.35E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 4.17E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 2.11E-06 2.11E-06 mr1110 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 6.53E-06 9.31E-09 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 1.47E-06 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 8.41E-07 7.27E-08 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 6.75E-06 NA mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 6.25E-08 1.23E-09 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 4.45E-06 2.12E-07 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 6.02E-09 4.65E-11 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 3.15E-06 3.37E-07 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 4.34E-06 6.86E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 3.18E-06 3.28E-08 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 7.65E-07 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 1.86E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 3.14E-06 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 NA 2.43E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 2.81E-08 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 1.03E-08 1.15E-10 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 4.90E-06 NA mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 9.69E-06 NA mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 7.54E-09 4.44E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 6.95E-06 NA mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 3.91E-09 NA mr1583_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 5.72E-09 1.27E-08 mr1583_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 4.44E-11 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610110374 2.39E-06 NA mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251