Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610058276:

Variant ID: vg0610058276 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10058276
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCTCACTATCAAGAGGGTGCGAAGCGACAATGGAGGAGAATTCAAGAACACTCAAGTGGAGGAATTTCTTGATGAAGAAGGAATCAAGCACGAGTTCT[C/T]
CGCCCCCTATGATCCTCCCCAAAATAGCATTGTTGAAAGGAAGAACCGAACCCTCATTGAAGCTGTAAGGGCAATGCTTGATGAGTACAAGACTTCGGAT

Reverse complement sequence

ATCCGAAGTCTTGTACTCATCAAGCATTGCCCTTACAGCTTCAATGAGGGTTCGGTTCTTCCTTTCAACAATGCTATTTTGGGGAGGATCATAGGGGGCG[G/A]
AGAACTCGTGCTTGATTCCTTCTTCATCAAGAAATTCCTCCACTTGAGTGTTCTTGAATTCTCCTCCATTGTCGCTTCGCACCCTCTTGATAGTGAGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 6.10% 0.99% 24.42% NA
All Indica  2759 53.90% 4.10% 1.59% 40.49% NA
All Japonica  1512 87.60% 11.20% 0.07% 1.12% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 19.00% 10.80% 1.01% 69.24% NA
Indica II  465 29.70% 1.90% 3.66% 64.73% NA
Indica III  913 84.80% 0.50% 0.88% 13.80% NA
Indica Intermediate  786 58.70% 4.30% 1.65% 35.37% NA
Temperate Japonica  767 97.70% 1.80% 0.00% 0.52% NA
Tropical Japonica  504 73.00% 26.20% 0.00% 0.79% NA
Japonica Intermediate  241 85.90% 10.00% 0.41% 3.73% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 8.90% 2.22% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610058276 C -> T LOC_Os06g17350.1 missense_variant ; p.Ser633Phe; MODERATE nonsynonymous_codon ; S633F Average:8.125; most accessible tissue: Callus, score: 26.431 benign 0.815 DELETERIOUS 0.03
vg0610058276 C -> DEL LOC_Os06g17350.1 N frameshift_variant Average:8.125; most accessible tissue: Callus, score: 26.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610058276 4.69E-09 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.62E-08 1.62E-08 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 2.60E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 3.25E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 9.43E-12 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 3.56E-08 5.19E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 2.09E-07 1.28E-09 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.62E-06 NA mr1094 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 3.97E-06 2.36E-07 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 3.84E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.24E-06 1.24E-06 mr1110 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 3.48E-07 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 1.73E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 3.57E-06 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 6.16E-11 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.28E-06 6.77E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.80E-06 1.07E-07 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 1.01E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 7.45E-06 5.21E-08 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 2.08E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.04E-06 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 1.50E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 8.47E-07 9.29E-10 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 4.15E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 8.40E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 1.62E-07 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 7.03E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 1.92E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 NA 9.75E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 1.96E-11 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 2.39E-06 3.09E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610058276 2.15E-07 7.01E-10 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251