| Variant ID: vg0609926308 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9926308 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.47, others allele: 0.00, population size: 99. )
GTTAGGAGGAATCAGATCTACAGCGTGTTTTTTTTTCTTTTGCTTTTTCGCTACTTTGGGAATCGGAAATTTTTTTCGCTGTTTTTTTTATTTTGACGGA[C/T]
GATGGAAGCACTTTTTATTTTTATAATAGTAGAGAATAGTTGAAAGTGAATAGGGGAATTAAAATTTCCAGCTGATCATCTCCCCACCAGTTACTTACAT
ATGTAAGTAACTGGTGGGGAGATGATCAGCTGGAAATTTTAATTCCCCTATTCACTTTCAACTATTCTCTACTATTATAAAAATAAAAAGTGCTTCCATC[G/A]
TCCGTCAAAATAAAAAAAACAGCGAAAAAAATTTCCGATTCCCAAAGTAGCGAAAAAGCAAAAGAAAAAAAAACACGCTGTAGATCTGATTCCTCCTAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.10% | 26.50% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 81.80% | 17.90% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 52.80% | 46.50% | 0.66% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 87.90% | 11.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.70% | 20.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 78.20% | 21.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 37.40% | 61.70% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 65.50% | 34.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 42.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609926308 | C -> T | LOC_Os06g17120.1 | downstream_gene_variant ; 3719.0bp to feature; MODIFIER | silent_mutation | Average:35.227; most accessible tissue: Callus, score: 53.205 | N | N | N | N |
| vg0609926308 | C -> T | LOC_Os06g17120-LOC_Os06g17130 | intergenic_region ; MODIFIER | silent_mutation | Average:35.227; most accessible tissue: Callus, score: 53.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609926308 | 6.69E-10 | NA | mr1068 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 3.62E-08 | 4.23E-10 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 1.52E-10 | NA | mr1090 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 1.58E-11 | 2.18E-18 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 6.88E-06 | NA | mr1111 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 5.22E-07 | 5.28E-08 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 5.85E-06 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 6.93E-06 | 1.16E-07 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | NA | 3.77E-06 | mr1128 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926308 | 1.16E-06 | NA | mr1144 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/