| Variant ID: vg0609926030 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9926030 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 103. )
TCACATATAATAGGATTTGAATTTTTTTTCTGCGTCAATCGGACAGATTTTTTTTCGCTTTTTTAACCGCATCTACAGAGTCCGATTCTTTTTTCTTTTC[G/A]
CCCGGTTTTTTCGCCCTTTTTTGGGATCGGACAGGTTTTTTAAAAAAAAATTCCTTTTTTTTCGCCCGGTTTTTTGTCCGCCCGATATTTTTTCGCAAAA
TTTTGCGAAAAAATATCGGGCGGACAAAAAACCGGGCGAAAAAAAAGGAATTTTTTTTTAAAAAACCTGTCCGATCCCAAAAAAGGGCGAAAAAACCGGG[C/T]
GAAAAGAAAAAAGAATCGGACTCTGTAGATGCGGTTAAAAAAGCGAAAAAAAATCTGTCCGATTGACGCAGAAAAAAAATTCAAATCCTATTATATGTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 12.70% | 3.43% | 1.44% | NA |
| All Indica | 2759 | 80.10% | 19.50% | 0.33% | 0.04% | NA |
| All Japonica | 1512 | 85.00% | 3.80% | 8.33% | 2.84% | NA |
| Aus | 269 | 88.10% | 0.00% | 6.32% | 5.58% | NA |
| Indica I | 595 | 91.80% | 7.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.50% | 20.90% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 85.70% | 7.60% | 6.00% | 0.78% | NA |
| Tropical Japonica | 504 | 85.10% | 0.00% | 9.92% | 4.96% | NA |
| Japonica Intermediate | 241 | 82.60% | 0.00% | 12.45% | 4.98% | NA |
| VI/Aromatic | 96 | 85.40% | 0.00% | 6.25% | 8.33% | NA |
| Intermediate | 90 | 92.20% | 2.20% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609926030 | G -> A | LOC_Os06g17120.1 | downstream_gene_variant ; 3441.0bp to feature; MODIFIER | silent_mutation | Average:31.029; most accessible tissue: Callus, score: 58.284 | N | N | N | N |
| vg0609926030 | G -> A | LOC_Os06g17120-LOC_Os06g17130 | intergenic_region ; MODIFIER | silent_mutation | Average:31.029; most accessible tissue: Callus, score: 58.284 | N | N | N | N |
| vg0609926030 | G -> DEL | N | N | silent_mutation | Average:31.029; most accessible tissue: Callus, score: 58.284 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609926030 | 5.20E-07 | NA | mr1065 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 4.19E-07 | 1.36E-15 | mr1065 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 2.09E-07 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 6.38E-07 | 2.97E-12 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 4.87E-09 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 4.98E-08 | 2.10E-19 | mr1068 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 8.92E-06 | NA | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | NA | 4.98E-12 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 5.76E-07 | NA | mr1087 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609926030 | 5.65E-08 | 6.46E-15 | mr1087 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/