Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609547477:

Variant ID: vg0609547477 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9547477
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCTCTTATAGTTTATAAAACTATATAATAGATATGTACATTCTGTGAGTAATCTTACAAATCATTTTGTCGGATGAATAAATGATCAAAATAAAAGTT[A/C]
TAGATATTAATGAGTTACACCAATTTGTTATTGATGATTTTTTCAGTTGAAATCATTTAGTATCTGAAAATGTTGTTTAAAGTTGTTATAATTTGAAATT

Reverse complement sequence

AATTTCAAATTATAACAACTTTAAACAACATTTTCAGATACTAAATGATTTCAACTGAAAAAATCATCAATAACAAATTGGTGTAACTCATTAATATCTA[T/G]
AACTTTTATTTTGATCATTTATTCATCCGACAAAATGATTTGTAAGATTACTCACAGAATGTACATATCTATTATATAGTTTTATAAACTATAAGAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	0.40%	4.89%	9.52%	NA
All Indica	2759	94.90%	0.00%	1.41%	3.70%	NA
All Japonica	1512	68.30%	1.10%	10.58%	20.04%	NA
Aus	269	81.80%	1.50%	6.32%	10.41%	NA
Indica I	595	93.10%	0.00%	1.18%	5.71%	NA
Indica II	465	94.20%	0.00%	1.29%	4.52%	NA
Indica III	913	96.20%	0.00%	1.20%	2.63%	NA
Indica Intermediate	786	95.20%	0.00%	1.91%	2.93%	NA
Temperate Japonica	767	68.20%	0.30%	8.21%	23.34%	NA
Tropical Japonica	504	72.20%	2.40%	13.29%	12.10%	NA
Japonica Intermediate	241	60.60%	0.80%	12.45%	26.14%	NA
VI/Aromatic	96	81.20%	1.00%	9.38%	8.33%	NA
Intermediate	90	83.30%	0.00%	6.67%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609547477	A -> C	LOC_Os06g16600.1	upstream_gene_variant ; 2548.0bp to feature; MODIFIER	silent_mutation	Average:18.566; most accessible tissue: Minghui63 flag leaf, score: 23.551	N	N	N	N
vg0609547477	A -> C	LOC_Os06g16610.1	upstream_gene_variant ; 2972.0bp to feature; MODIFIER	silent_mutation	Average:18.566; most accessible tissue: Minghui63 flag leaf, score: 23.551	N	N	N	N
vg0609547477	A -> C	LOC_Os06g16620.1	upstream_gene_variant ; 4838.0bp to feature; MODIFIER	silent_mutation	Average:18.566; most accessible tissue: Minghui63 flag leaf, score: 23.551	N	N	N	N
vg0609547477	A -> C	LOC_Os06g16600-LOC_Os06g16610	intergenic_region ; MODIFIER	silent_mutation	Average:18.566; most accessible tissue: Minghui63 flag leaf, score: 23.551	N	N	N	N
vg0609547477	A -> DEL	N	N	silent_mutation	Average:18.566; most accessible tissue: Minghui63 flag leaf, score: 23.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609547477	5.95E-06	5.95E-06	mr1452	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609547477	1.83E-07	6.80E-06	mr1709	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251