Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609332559:

Variant ID: vg0609332559 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9332559
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.10, A: 0.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAATCTTAGCTAAGATTGATGCTATCATTGAGATGGTATTGCGGAAGATTCTTACGTTACACTCGCATCATATTTCCCATGAAACTAGGATCACCATC[G/A,T]
TTTGGAGTGGTCGATGGGGGTTATTGGGGGCTTCAAGCACGAGATTCCACCAAAGCACAGTAGAGTGGCAGTCGTCCCATTTGTTCATTTGTAAGTCACT

Reverse complement sequence

AGTGACTTACAAATGAACAAATGGGACGACTGCCACTCTACTGTGCTTTGGTGGAATCTCGTGCTTGAAGCCCCCAATAACCCCCATCGACCACTCCAAA[C/T,A]
GATGGTGATCCTAGTTTCATGGGAAATATGATGCGAGTGTAACGTAAGAATCTTCCGCAATACCATCTCAATGATAGCATCAATCTTAGCTAAGATTAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.40%	6.30%	0.17%	0.00%	T: 0.04%
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	97.10%	2.40%	0.46%	0.00%	NA
Aus	269	12.30%	87.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	95.60%	3.80%	0.65%	0.00%	NA
Tropical Japonica	504	99.20%	0.60%	0.20%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	91.10%	5.60%	1.11%	0.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609332559	G -> T	LOC_Os06g16350.1	upstream_gene_variant ; 4348.0bp to feature; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> T	LOC_Os06g16370.1	upstream_gene_variant ; 3800.0bp to feature; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> T	LOC_Os06g16360.1	downstream_gene_variant ; 654.0bp to feature; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> T	LOC_Os06g16350-LOC_Os06g16360	intergenic_region ; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> A	LOC_Os06g16350.1	upstream_gene_variant ; 4348.0bp to feature; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> A	LOC_Os06g16370.1	upstream_gene_variant ; 3800.0bp to feature; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> A	LOC_Os06g16360.1	downstream_gene_variant ; 654.0bp to feature; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N
vg0609332559	G -> A	LOC_Os06g16350-LOC_Os06g16360	intergenic_region ; MODIFIER	silent_mutation	Average:63.067; most accessible tissue: Zhenshan97 young leaf, score: 81.6	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609332559	NA	8.21E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559	NA	1.27E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559	1.30E-06	NA	mr1552	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559	NA	2.26E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559	NA	3.14E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559	NA	5.09E-31	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609332559	NA	6.17E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251