Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609221063:

Variant ID: vg0609221063 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9221063
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATAGTATCCTAATCTGCTTCTAAATCAATAAGATTAGCCATGTAGTGTCCTTTCCGCCTTCCTCCACATGCACCATACAATTTCATACACTAAAACGA[G/A]
TATTTTACAAGTTTATGCACTAAATTACACTCACCTAACAAATACAATTTACTCTACTATAATACTCACTTGACCATCAATCTAATCATGACTTTGAGTC

Reverse complement sequence

GACTCAAAGTCATGATTAGATTGATGGTCAAGTGAGTATTATAGTAGAGTAAATTGTATTTGTTAGGTGAGTGTAATTTAGTGCATAAACTTGTAAAATA[C/T]
TCGTTTTAGTGTATGAAATTGTATGGTGCATGTGGAGGAAGGCGGAAAGGACACTACATGGCTAATCTTATTGATTTAGAAGCAGATTAGGATACTATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	7.90%	1.44%	43.36%	NA
All Indica	2759	26.40%	0.30%	0.47%	72.82%	NA
All Japonica	1512	72.20%	23.60%	3.51%	0.73%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	11.10%	0.20%	1.34%	87.39%	NA
Indica II	465	21.10%	0.60%	0.00%	78.28%	NA
Indica III	913	35.60%	0.00%	0.22%	64.18%	NA
Indica Intermediate	786	30.50%	0.50%	0.38%	68.58%	NA
Temperate Japonica	767	47.60%	44.70%	6.91%	0.78%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	93.40%	5.80%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	7.80%	2.22%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609221063	G -> A	LOC_Os06g16200.1	upstream_gene_variant ; 263.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467	N	N	N	N
vg0609221063	G -> A	LOC_Os06g16190.1	downstream_gene_variant ; 1194.0bp to feature; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467	N	N	N	N
vg0609221063	G -> A	LOC_Os06g16190-LOC_Os06g16200	intergenic_region ; MODIFIER	silent_mutation	Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467	N	N	N	N
vg0609221063	G -> DEL	N	N	silent_mutation	Average:63.007; most accessible tissue: Zhenshan97 panicle, score: 90.467	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0609221063	G	A	-0.02	-0.01	-0.01	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609221063	NA	1.37E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	7.26E-11	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	2.88E-06	3.34E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	3.60E-10	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	2.68E-13	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	1.62E-08	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	6.61E-11	6.37E-40	mr1137_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	2.70E-06	5.41E-14	mr1137_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	4.82E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	7.00E-09	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	9.85E-08	7.28E-27	mr1617_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	7.17E-10	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	3.82E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609221063	NA	4.95E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251