Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608672147:

Variant ID: vg0608672147 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8672147
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGCAAAAAGGTGGCGATGCGCCGAGATTGTATTGAACGTATGTGTTAAAAATTACATAGGGCTCGGGGTCTATTTATACCCGAGAATTACAAGATATG[T/C]
CCATACCGGACACGACCACTATCTCTAACAAACTCTAAGATACCATAAGTCTTTGCGGCAGACTTTTGCCCAAACATATCTCTAAGGAAGTTACACAAAA

Reverse complement sequence

TTTTGTGTAACTTCCTTAGAGATATGTTTGGGCAAAAGTCTGCCGCAAAGACTTATGGTATCTTAGAGTTTGTTAGAGATAGTGGTCGTGTCCGGTATGG[A/G]
CATATCTTGTAATTCTCGGGTATAAATAGACCCCGAGCCCTATGTAATTTTTAACACATACGTTCAATACAATCTCGGCGCATCGCCACCTTTTTGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.50%	20.70%	3.20%	31.68%	NA
All Indica	2759	8.10%	33.70%	5.33%	52.81%	NA
All Japonica	1512	99.00%	0.10%	0.07%	0.79%	NA
Aus	269	85.90%	13.40%	0.00%	0.74%	NA
Indica I	595	5.00%	39.70%	4.03%	51.26%	NA
Indica II	465	7.10%	15.50%	6.02%	71.40%	NA
Indica III	913	8.10%	47.80%	5.48%	38.66%	NA
Indica Intermediate	786	11.10%	23.80%	5.73%	59.41%	NA
Temperate Japonica	767	99.10%	0.00%	0.13%	0.78%	NA
Tropical Japonica	504	99.20%	0.20%	0.00%	0.60%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	61.10%	6.70%	3.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608672147	T -> C	LOC_Os06g15270.1	upstream_gene_variant ; 1175.0bp to feature; MODIFIER	silent_mutation	Average:13.595; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg0608672147	T -> C	LOC_Os06g15280.1	upstream_gene_variant ; 637.0bp to feature; MODIFIER	silent_mutation	Average:13.595; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg0608672147	T -> C	LOC_Os06g15270-LOC_Os06g15280	intergenic_region ; MODIFIER	silent_mutation	Average:13.595; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N
vg0608672147	T -> DEL	N	N	silent_mutation	Average:13.595; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608672147	8.65E-09	1.94E-11	mr1570	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608672147	4.41E-09	2.51E-12	mr1570	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608672147	NA	2.71E-06	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251