Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608669135:

Variant ID: vg0608669135 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8669135
Reference Allele: T	Alternative Allele: A,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAAACCGTAGCCAGGCTAAGCTGGAGTTATATTAAGGAGAATAGAAAGTATTTACAATATCACCAAGGGAGGTGAAAGAGAGAAAAATAAAGAAACA[T/A,G]
GAAGAAAAATAGAAAAGAAACACACACTAAATGAAATGAAAATCTAAGCGGATATTCTCGCAATATTTTTTGCCCCACACATGCTCCATAGCTTGATTTC

Reverse complement sequence

GAAATCAAGCTATGGAGCATGTGTGGGGCAAAAAATATTGCGAGAATATCCGCTTAGATTTTCATTTCATTTAGTGTGTGTTTCTTTTCTATTTTTCTTC[A/T,C]
TGTTTCTTTATTTTTCTCTCTTTCACCTCCCTTGGTGATATTGTAAATACTTTCTATTCTCCTTAATATAACTCCAGCTTAGCCTGGCTACGGTTTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	8.20%	3.70%	13.22%	G: 0.04%
All Indica	2759	59.60%	13.70%	5.91%	20.80%	NA
All Japonica	1512	96.90%	0.10%	0.60%	2.45%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	63.50%	10.80%	5.88%	19.83%	NA
Indica II	465	44.30%	20.40%	6.24%	29.03%	NA
Indica III	913	67.40%	9.20%	5.04%	18.40%	NA
Indica Intermediate	786	56.60%	17.20%	6.74%	19.47%	NA
Temperate Japonica	767	97.50%	0.00%	0.65%	1.83%	NA
Tropical Japonica	504	96.40%	0.00%	0.79%	2.78%	NA
Japonica Intermediate	241	95.90%	0.40%	0.00%	3.73%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	8.90%	3.33%	14.44%	G: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608669135	T -> G	LOC_Os06g15260.1	upstream_gene_variant ; 2807.0bp to feature; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> G	LOC_Os06g15280.1	upstream_gene_variant ; 3649.0bp to feature; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> G	LOC_Os06g15270.1	downstream_gene_variant ; 425.0bp to feature; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> G	LOC_Os06g15260-LOC_Os06g15270	intergenic_region ; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> A	LOC_Os06g15260.1	upstream_gene_variant ; 2807.0bp to feature; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> A	LOC_Os06g15280.1	upstream_gene_variant ; 3649.0bp to feature; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> A	LOC_Os06g15270.1	downstream_gene_variant ; 425.0bp to feature; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> A	LOC_Os06g15260-LOC_Os06g15270	intergenic_region ; MODIFIER	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0608669135	T -> DEL	N	N	silent_mutation	Average:55.861; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608669135	2.88E-07	1.34E-06	mr1125	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608669135	8.44E-06	NA	mr1676	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608669135	NA	8.49E-06	mr1804	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608669135	2.90E-06	9.15E-07	mr1971	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251