RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0608277816:

Variant ID: vg0608277816 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8277816
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, C: 0.48, G: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGAACAGCTTATTTATTATTTATAAAAATAATGCTAAATTATTTATAAAAATAATGCTAAAGAAATCCTATCTCGCTATATTAATTAATTATAAGGAC[A/C]
GTATAGATCGCCTTATAATTATATAAAAAATAAATATCTAGACCATAAATTTTGATATACCAAATGACAATAGTATCTTTCATATTCAAACAGAAATAAC

Reverse complement sequence

GTTATTTCTGTTTGAATATGAAAGATACTATTGTCATTTGGTATATCAAAATTTATGGTCTAGATATTTATTTTTTATATAATTATAAGGCGATCTATAC[T/G]
GTCCTTATAATTAATTAATATAGCGAGATAGGATTTCTTTAGCATTATTTTTATAAATAATTTAGCATTATTTTTATAAATAATAAATAAGCTGTTCTTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	38.50%	0.28%	0.00%	NA
All Indica	2759	67.20%	32.50%	0.36%	0.00%	NA
All Japonica	1512	59.70%	40.30%	0.07%	0.00%	NA
Aus	269	7.40%	92.60%	0.00%	0.00%	NA
Indica I	595	58.30%	41.20%	0.50%	0.00%	NA
Indica II	465	93.80%	5.80%	0.43%	0.00%	NA
Indica III	913	51.70%	47.90%	0.44%	0.00%	NA
Indica Intermediate	786	76.10%	23.80%	0.13%	0.00%	NA
Temperate Japonica	767	28.30%	71.70%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.40%	0.20%	0.00%	NA
Japonica Intermediate	241	78.40%	21.60%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	17.80%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608277816	A -> C	LOC_Os06g14700.1	downstream_gene_variant ; 4597.0bp to feature; MODIFIER	silent_mutation	Average:26.047; most accessible tissue: Callus, score: 61.209	N	N	N	N
vg0608277816	A -> C	LOC_Os06g14700-LOC_Os06g14710	intergenic_region ; MODIFIER	silent_mutation	Average:26.047; most accessible tissue: Callus, score: 61.209	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608277816	NA	3.86E-10	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816	NA	7.52E-11	mr1328	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816	NA	2.19E-12	mr1446	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816	NA	8.75E-08	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816	NA	1.17E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816	1.45E-06	5.62E-10	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816	NA	4.98E-07	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0608277816:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact