Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608142371:

Variant ID: vg0608142371 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8142371
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCCGTGCTGCAGCTGGCTACAGATCTGTAGCCCGCTGCTCTTCTCTCTCTTTCTTTATCTCTTTAAAATATATTTATAGTTGGCTTATAGCCTGCTAT[T/A]
CTACCTGATCTTAGCAAAATTTCAAGACTAAAAAAAAGACCAGCAAAGCGATATTCTTAACTTCAGGAAAAAAAGATTATTAAATGGAACCCAGTACTAG

Reverse complement sequence

CTAGTACTGGGTTCCATTTAATAATCTTTTTTTCCTGAAGTTAAGAATATCGCTTTGCTGGTCTTTTTTTTAGTCTTGAAATTTTGCTAAGATCAGGTAG[A/T]
ATAGCAGGCTATAAGCCAACTATAAATATATTTTAAAGAGATAAAGAAAGAGAGAGAAGAGCAGCGGGCTACAGATCTGTAGCCAGCTGCAGCACGGACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 12.10% 0.00% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 84.50% 15.50% 0.00% 0.00% NA
Aus  269 7.80% 92.20% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 73.90% 26.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608142371 T -> A LOC_Os06g14480.1 upstream_gene_variant ; 1118.0bp to feature; MODIFIER silent_mutation Average:96.823; most accessible tissue: Zhenshan97 root, score: 98.646 N N N N
vg0608142371 T -> A LOC_Os06g14490.1 upstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:96.823; most accessible tissue: Zhenshan97 root, score: 98.646 N N N N
vg0608142371 T -> A LOC_Os06g14490.2 upstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:96.823; most accessible tissue: Zhenshan97 root, score: 98.646 N N N N
vg0608142371 T -> A LOC_Os06g14480-LOC_Os06g14490 intergenic_region ; MODIFIER silent_mutation Average:96.823; most accessible tissue: Zhenshan97 root, score: 98.646 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608142371 T A 0.04 0.01 -0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608142371 NA 6.76E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 2.10E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.59E-08 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.68E-12 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 7.58E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 2.10E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.66E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.31E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 4.26E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 6.59E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 4.34E-06 NA mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.93E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 2.05E-07 3.52E-29 mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 4.44E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.60E-16 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 9.84E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 4.16E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 9.93E-06 9.93E-06 mr1711_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.75E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608142371 NA 1.88E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251