Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608011454:

Variant ID: vg0608011454 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8011454
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTATCTATTCCTCTTTATATTTGGATTGCTATATGTTGGTCAGCGGTATAGTGTTGGTCTCCCTGCAGTCACTTACTGCCTGCTCATAGCTAAAAATT[A/G]
TTATATTTTAGAACGGAGGAAGTATGTATTATCCGAAAGCTTACGTTTATTAGAAAAGAAGCAGTGGGAACTGTCCATCGTCAAAAAAAATATAGCAACC

Reverse complement sequence

GGTTGCTATATTTTTTTTGACGATGGACAGTTCCCACTGCTTCTTTTCTAATAAACGTAAGCTTTCGGATAATACATACTTCCTCCGTTCTAAAATATAA[T/C]
AATTTTTAGCTATGAGCAGGCAGTAAGTGACTGCAGGGAGACCAACACTATACCGCTGACCAACATATAGCAATCCAAATATAAAGAGGAATAGATACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 13.20% 0.15% 35.67% NA
All Indica  2759 40.70% 1.10% 0.00% 58.17% NA
All Japonica  1512 59.90% 38.60% 0.40% 1.19% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 62.40% 0.30% 0.00% 37.31% NA
Indica II  465 10.30% 0.20% 0.00% 89.46% NA
Indica III  913 42.50% 2.60% 0.00% 54.87% NA
Indica Intermediate  786 40.20% 0.50% 0.00% 59.29% NA
Temperate Japonica  767 36.10% 62.50% 0.26% 1.17% NA
Tropical Japonica  504 93.50% 5.40% 0.40% 0.79% NA
Japonica Intermediate  241 65.10% 32.00% 0.83% 2.07% NA
VI/Aromatic  96 72.90% 0.00% 0.00% 27.08% NA
Intermediate  90 51.10% 8.90% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608011454 A -> G LOC_Os06g14370.1 downstream_gene_variant ; 381.0bp to feature; MODIFIER silent_mutation Average:73.671; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0608011454 A -> G LOC_Os06g14370.2 downstream_gene_variant ; 381.0bp to feature; MODIFIER silent_mutation Average:73.671; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0608011454 A -> G LOC_Os06g14370.4 downstream_gene_variant ; 381.0bp to feature; MODIFIER silent_mutation Average:73.671; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0608011454 A -> G LOC_Os06g14370.3 downstream_gene_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:73.671; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0608011454 A -> G LOC_Os06g14350-LOC_Os06g14370 intergenic_region ; MODIFIER silent_mutation Average:73.671; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N
vg0608011454 A -> DEL N N silent_mutation Average:73.671; most accessible tissue: Zhenshan97 flower, score: 91.386 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0608011454 A G -0.12 -0.02 0.0 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608011454 2.01E-07 8.60E-08 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608011454 9.42E-08 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608011454 3.59E-06 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608011454 9.72E-11 NA mr1829_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608011454 8.82E-06 NA mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608011454 4.21E-08 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251