Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607988535:

Variant ID: vg0607988535 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7988535
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAATGAAGGGGGGTTCCACTCGCTTACTTTACTCTGGTTTGAATCAAATTTAGCTTGATACGGGTGCCTAAGTTTATACTGACGGGGTATATATATGG[C/T]
GAAAATAGATAAACTATAGGTAATTTTTTTTGAATCGGGTTCCTGGGCACCCCCTAGCTATATTAGCTCCACCCCTGCCAGTGAGTAGGGAAGAAAATAG

Reverse complement sequence

CTATTTTCTTCCCTACTCACTGGCAGGGGTGGAGCTAATATAGCTAGGGGGTGCCCAGGAACCCGATTCAAAAAAAATTACCTATAGTTTATCTATTTTC[G/A]
CCATATATATACCCCGTCAGTATAAACTTAGGCACCCGTATCAAGCTAAATTTGATTCAAACCAGAGTAAAGTAAGCGAGTGGAACCCCCCTTCATTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	5.40%	0.00%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	11.90%	88.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607988535	C -> T	LOC_Os06g14324.2	upstream_gene_variant ; 586.0bp to feature; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N
vg0607988535	C -> T	LOC_Os06g14310.1	downstream_gene_variant ; 4676.0bp to feature; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N
vg0607988535	C -> T	LOC_Os06g14340.1	downstream_gene_variant ; 3487.0bp to feature; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N
vg0607988535	C -> T	LOC_Os06g14324.1	intron_variant ; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0607988535	C	T	-0.04	-0.02	-0.02	-0.03	-0.04	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607988535	NA	1.23E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	7.62E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	1.25E-12	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	2.99E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	1.79E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	7.39E-06	mr1349	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	8.61E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	1.89E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	3.62E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	3.74E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	4.23E-06	1.28E-07	mr1847	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	7.58E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988535	NA	2.34E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251