Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607961607:

Variant ID: vg0607961607 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7961607
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCGCTGCGCCTCCCGCTGCAAATCTCATCCTCCCGCATTGCCGGCACTTCGCGAGGAGGCGAGGCCGCTGTCGCAAAACCCCTCGCCGGTCTCCAGCC[A/G]
TTGCCACTTCGCCATCTCCGTTATCCTCCCAAATGTTGCGCACCTCTTGCCGCAAATAGCTTCCTCCCGCCGCAAATCGCAGCCTCCCCAATCCCCCCGC

Reverse complement sequence

GCGGGGGGATTGGGGAGGCTGCGATTTGCGGCGGGAGGAAGCTATTTGCGGCAAGAGGTGCGCAACATTTGGGAGGATAACGGAGATGGCGAAGTGGCAA[T/C]
GGCTGGAGACCGGCGAGGGGTTTTGCGACAGCGGCCTCGCCTCCTCGCGAAGTGCCGGCAATGCGGGAGGATGAGATTTGCAGCGGGAGGCGCAGCGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.60% 22.00% 1.25% 0.13% NA
All Indica  2759 98.50% 1.40% 0.11% 0.00% NA
All Japonica  1512 37.20% 59.30% 3.11% 0.40% NA
Aus  269 91.80% 7.80% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.50% 1.30% 0.22% 0.00% NA
Indica Intermediate  786 98.00% 1.90% 0.13% 0.00% NA
Temperate Japonica  767 61.40% 35.10% 2.74% 0.78% NA
Tropical Japonica  504 5.40% 91.50% 3.17% 0.00% NA
Japonica Intermediate  241 26.60% 69.30% 4.15% 0.00% NA
VI/Aromatic  96 34.40% 62.50% 3.12% 0.00% NA
Intermediate  90 67.80% 26.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607961607 A -> G LOC_Os06g14280.1 downstream_gene_variant ; 2272.0bp to feature; MODIFIER silent_mutation Average:90.589; most accessible tissue: Zhenshan97 flower, score: 96.087 N N N N
vg0607961607 A -> G LOC_Os06g14270.1 intron_variant ; MODIFIER silent_mutation Average:90.589; most accessible tissue: Zhenshan97 flower, score: 96.087 N N N N
vg0607961607 A -> DEL N N silent_mutation Average:90.589; most accessible tissue: Zhenshan97 flower, score: 96.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607961607 A G 0.04 0.03 0.04 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607961607 6.73E-06 6.73E-06 mr1046_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 1.59E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 5.67E-06 2.63E-06 mr1283_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 4.60E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 2.10E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 6.35E-06 2.40E-06 mr1358_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 3.71E-07 1.30E-08 mr1482_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 7.90E-06 NA mr1482_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 9.52E-06 mr1499_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 1.57E-06 NA mr1567_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 1.15E-06 NA mr1580_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 2.20E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 1.23E-06 NA mr1641_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 3.80E-06 3.80E-06 mr1641_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 3.65E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 2.30E-06 2.29E-06 mr1711_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 3.80E-06 NA mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 3.75E-06 1.53E-06 mr1718_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 1.40E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 9.19E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 1.39E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 2.66E-06 NA mr1806_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 4.14E-06 NA mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 1.41E-06 9.29E-08 mr1831_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 2.06E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607961607 NA 1.85E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251