Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607674962:

Variant ID: vg0607674962 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7674962
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGTTGACAGAGAAGGGGGGTGTTAGGTGATCGACCGCCCCGGTGGCTGGCAGGGTGGGACCCGCACGTCGCACCTGTTTAGGTGAGCTTAAGATTCTGA[G/C]
AAACTGTTGGTTGATAGCCATCTTATGAGAATACTTCTTACTAATTTAGTGCGTTTTCTGGATTCTACAACTTTAGTTTTTGAGAATCTGAATGAAATAC

Reverse complement sequence

GTATTTCATTCAGATTCTCAAAAACTAAAGTTGTAGAATCCAGAAAACGCACTAAATTAGTAAGAAGTATTCTCATAAGATGGCTATCAACCAACAGTTT[C/G]
TCAGAATCTTAAGCTCACCTAAACAGGTGCGACGTGCGGGTCCCACCCTGCCAGCCACCGGGGCGGTCGATCACCTAACACCCCCCTTCTCTGTCAACAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.50%	20.50%	0.08%	0.00%	NA
All Indica	2759	67.40%	32.50%	0.14%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	77.30%	22.70%	0.00%	0.00%	NA
Indica I	595	67.90%	31.90%	0.17%	0.00%	NA
Indica II	465	95.30%	4.70%	0.00%	0.00%	NA
Indica III	913	50.60%	49.30%	0.11%	0.00%	NA
Indica Intermediate	786	70.00%	29.80%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607674962	G -> C	LOC_Os06g13830.1	upstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769	N	N	N	N
vg0607674962	G -> C	LOC_Os06g13820.1	downstream_gene_variant ; 4927.0bp to feature; MODIFIER	silent_mutation	Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769	N	N	N	N
vg0607674962	G -> C	LOC_Os06g13820.2	downstream_gene_variant ; 4928.0bp to feature; MODIFIER	silent_mutation	Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769	N	N	N	N
vg0607674962	G -> C	LOC_Os06g13830-LOC_Os06g13839	intergenic_region ; MODIFIER	silent_mutation	Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0607674962	G	C	0.01	-0.01	-0.03	-0.01	0.01	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607674962	NA	3.27E-06	mr1184_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	NA	1.68E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	4.09E-06	4.09E-06	mr1284_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	2.64E-06	2.64E-06	mr1286_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	NA	4.78E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	7.93E-06	NA	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	7.22E-07	7.22E-07	mr1374_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	NA	5.55E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	NA	2.98E-06	mr1683_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	NA	3.02E-06	mr1816_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	1.47E-06	1.47E-06	mr1816_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	7.65E-06	7.64E-06	mr1822_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	2.60E-06	2.60E-06	mr1822_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962	8.89E-06	8.89E-06	mr1847_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251