Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607562910:

Variant ID: vg0607562910 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7562910
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGCTTAGGCTCAATTCGATTTCATGGTTTGGAGAGAATTTTCAGCGTACACAAAACAAGGAAACTCATTAGCACATGATTAATTAAGTACTAACTATT[A/G]
TAAAATCAAAAAAAATAAATTTATTTGATTTTTTTAAAACAACTTCTATATAGAAACTTTTTTTTTTGTCAAAAATGCACCATTTAACGGTTTAAAAAGT

Reverse complement sequence

ACTTTTTAAACCGTTAAATGGTGCATTTTTGACAAAAAAAAAAGTTTCTATATAGAAGTTGTTTTAAAAAAATCAAATAAATTTATTTTTTTTGATTTTA[T/C]
AATAGTTAGTACTTAATTAATCATGTGCTAATGAGTTTCCTTGTTTTGTGTACGCTGAAAATTCTCTCCAAACCATGAAATCGAATTGAGCCTAAGCCAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	16.60%	7.74%	9.04%	NA
All Indica	2759	43.60%	28.30%	12.98%	15.15%	NA
All Japonica	1512	99.50%	0.00%	0.26%	0.26%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	50.10%	8.40%	15.46%	26.05%	NA
Indica II	465	70.30%	6.00%	9.03%	14.62%	NA
Indica III	913	20.80%	55.60%	14.46%	9.09%	NA
Indica Intermediate	786	49.40%	24.70%	11.70%	14.25%	NA
Temperate Japonica	767	99.50%	0.00%	0.26%	0.26%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	5.60%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607562910	A -> G	LOC_Os06g13640.1	upstream_gene_variant ; 4543.0bp to feature; MODIFIER	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0607562910	A -> G	LOC_Os06g13640.2	upstream_gene_variant ; 4480.0bp to feature; MODIFIER	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0607562910	A -> G	LOC_Os06g13650.1	downstream_gene_variant ; 814.0bp to feature; MODIFIER	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0607562910	A -> G	LOC_Os06g13650.2	downstream_gene_variant ; 827.0bp to feature; MODIFIER	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0607562910	A -> G	LOC_Os06g13650.3	downstream_gene_variant ; 1845.0bp to feature; MODIFIER	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0607562910	A -> G	LOC_Os06g13640-LOC_Os06g13650	intergenic_region ; MODIFIER	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0607562910	A -> DEL	N	N	silent_mutation	Average:43.168; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607562910	NA	2.20E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607562910	2.51E-06	2.50E-06	mr1651_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607562910	NA	8.10E-06	mr1817_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251