| Variant ID: vg0607367426 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7367426 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTAAATTCAGTCTAGTTTTAGTAAGGCCAAGTAAGGTTGTGTTCGTGCCGGTCGACGTCATCGTCAACGCCATCATGCAAAAAAATGAAGGAGGAGAGGC[G/A]
CAAGCACGAGGTGGTGGCGCTGTACGAGCTAGGGCTTCGACATGCTGGTGTTGGGGGTGGCACTGTTCGAGAGGGCTCCTCGCCGCAGGTCTCACACAAA
TTTGTGTGAGACCTGCGGCGAGGAGCCCTCTCGAACAGTGCCACCCCCAACACCAGCATGTCGAAGCCCTAGCTCGTACAGCGCCACCACCTCGTGCTTG[C/T]
GCCTCTCCTCCTTCATTTTTTTGCATGATGGCGTTGACGATGACGTCGACCGGCACGAACACAACCTTACTTGGCCTTACTAAAACTAGACTGAATTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 6.60% | 0.44% | 7.87% | NA |
| All Indica | 2759 | 89.10% | 0.50% | 0.04% | 10.40% | NA |
| All Japonica | 1512 | 90.70% | 8.00% | 1.06% | 0.20% | NA |
| Aus | 269 | 6.30% | 63.60% | 1.49% | 28.62% | NA |
| Indica I | 595 | 97.00% | 0.00% | 0.17% | 2.86% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.00% | 1.08% | NA |
| Indica III | 913 | 78.80% | 0.10% | 0.00% | 21.14% | NA |
| Indica Intermediate | 786 | 89.20% | 1.70% | 0.00% | 9.16% | NA |
| Temperate Japonica | 767 | 98.60% | 0.40% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 77.00% | 21.40% | 1.19% | 0.40% | NA |
| Japonica Intermediate | 241 | 94.60% | 4.10% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607367426 | G -> A | LOC_Os06g13370.1 | downstream_gene_variant ; 1267.0bp to feature; MODIFIER | silent_mutation | Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0607367426 | G -> A | LOC_Os06g13380.1 | downstream_gene_variant ; 365.0bp to feature; MODIFIER | silent_mutation | Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0607367426 | G -> A | LOC_Os06g13390.1 | downstream_gene_variant ; 1711.0bp to feature; MODIFIER | silent_mutation | Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0607367426 | G -> A | LOC_Os06g13370-LOC_Os06g13380 | intergenic_region ; MODIFIER | silent_mutation | Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0607367426 | G -> DEL | N | N | silent_mutation | Average:59.097; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607367426 | NA | 3.64E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 2.07E-09 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 8.64E-17 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | 2.59E-08 | 1.43E-26 | mr1120 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 4.39E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 7.84E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 3.17E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 5.15E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 7.53E-09 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607367426 | NA | 1.08E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/