Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607146332:

Variant ID: vg0607146332 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 7146332
Reference Allele: CAlternative Allele: CTGCCTGCT
Primary Allele: CSecondary Allele: CTGCCTGCT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CATCAGATGGAGATTTTTCGATCGACAGGAGGATGATGATGCATGAAACGGATTGATTTGGGAAGGTGTGAGCTGTGGAGTGTACGTTTTATCTGCCTGC[C/CTGCCTGCT]
TGCCTGGCCCTGAGAGCTTCTCATGGAGTTCGAACAGAAGCCAACTTGATTAGCGTTGTGTGTACATCAGCTTACTTGATTAGCAAAAACATTGCCTTTG

Reverse complement sequence

CAAAGGCAATGTTTTTGCTAATCAAGTAAGCTGATGTACACACAACGCTAATCAAGTTGGCTTCTGTTCGAACTCCATGAGAAGCTCTCAGGGCCAGGCA[G/AGCAGGCAG]
GCAGGCAGATAAAACGTACACTCCACAGCTCACACCTTCCCAAATCAATCCGTTTCATGCATCATCATCCTCCTGTCGATCGAAAAATCTCCATCTGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CTGCCTGCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 39.30% 0.13% 0.00% NA
All Indica  2759 33.90% 65.90% 0.18% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 34.10% 65.90% 0.00% 0.00% NA
Indica II  465 8.60% 91.00% 0.43% 0.00% NA
Indica III  913 49.20% 50.70% 0.11% 0.00% NA
Indica Intermediate  786 31.00% 68.70% 0.25% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607146332 C -> CTGCCTGCT LOC_Os06g13040.1 upstream_gene_variant ; 259.0bp to feature; MODIFIER silent_mutation Average:80.945; most accessible tissue: Zhenshan97 flower, score: 96.077 N N N N
vg0607146332 C -> CTGCCTGCT LOC_Os06g13050.1 downstream_gene_variant ; 2628.0bp to feature; MODIFIER silent_mutation Average:80.945; most accessible tissue: Zhenshan97 flower, score: 96.077 N N N N
vg0607146332 C -> CTGCCTGCT LOC_Os06g13040-LOC_Os06g13050 intergenic_region ; MODIFIER silent_mutation Average:80.945; most accessible tissue: Zhenshan97 flower, score: 96.077 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607146332 C CTGCC* 0.03 0.06 0.06 -0.01 0.07 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607146332 NA 7.91E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 1.04E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 1.77E-06 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 6.03E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 3.42E-09 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 2.87E-06 mr1989 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 4.71E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 5.02E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 8.39E-06 NA mr1686_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 8.88E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607146332 NA 6.85E-07 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251