| Variant ID: vg0606988364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 6988364 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, A: 0.01, others allele: 0.00, population size: 123. )
GTAATTATCATTTTTTATTCGATTTATCGTCAAATGTTTTAAAGCATGACTTAATTTTTTTTATATTTGCACAAAAATTGAATGGTCGAATATAAATTTC[G/A]
GGTATTCCGAGGAATACCTAGGAACCCATGTGTTCGCCAGAATCCTCATATTTGATTCTAATCCCTTTAGGGGAGATATCCTCTCGTGTACCCTTTTCCT
AGGAAAAGGGTACACGAGAGGATATCTCCCCTAAAGGGATTAGAATCAAATATGAGGATTCTGGCGAACACATGGGTTCCTAGGTATTCCTCGGAATACC[C/T]
GAAATTTATATTCGACCATTCAATTTTTGTGCAAATATAAAAAAAATTAAGTCATGCTTTAAAACATTTGACGATAAATCGAATAAAAAATGATAATTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.90% | 13.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 78.20% | 21.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 72.60% | 27.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 76.80% | 23.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0606988364 | G -> A | LOC_Os06g12790.1 | upstream_gene_variant ; 2575.0bp to feature; MODIFIER | silent_mutation | Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0606988364 | G -> A | LOC_Os06g12790.3 | upstream_gene_variant ; 2575.0bp to feature; MODIFIER | silent_mutation | Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0606988364 | G -> A | LOC_Os06g12780.1 | downstream_gene_variant ; 2051.0bp to feature; MODIFIER | silent_mutation | Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0606988364 | G -> A | LOC_Os06g12780-LOC_Os06g12790 | intergenic_region ; MODIFIER | silent_mutation | Average:48.075; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0606988364 | 1.18E-06 | NA | mr1068 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | 3.60E-07 | NA | mr1090 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | NA | 2.58E-09 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | 2.17E-06 | NA | mr1121 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | NA | 3.82E-08 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | 9.96E-08 | NA | mr1211 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | NA | 5.04E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | NA | 6.34E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | NA | 6.40E-06 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0606988364 | NA | 9.57E-08 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/