Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606936078:

Variant ID: vg0606936078 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6936078
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGCGCCACGTCAGTCAAAACCGCCTACCAAACCTCCGAGGGATCTCGTTTGTACCGGTTTTGACAGTTTAGGGACCGGTTATATCTGGTTTTGGGGTT[C/T]
AAGGACGAAAATCGGATTCGATGTAAAGTTAAGAGACCTCAGATGAACTTCCATTCTTTGAAGAAAGGCTTTAGAATAATGTACAAAAATGATGTTAAAT

Reverse complement sequence

ATTTAACATCATTTTTGTACATTATTCTAAAGCCTTTCTTCAAAGAATGGAAGTTCATCTGAGGTCTCTTAACTTTACATCGAATCCGATTTTCGTCCTT[G/A]
AACCCCAAAACCAGATATAACCGGTCCCTAAACTGTCAAAACCGGTACAAACGAGATCCCTCGGAGGTTTGGTAGGCGGTTTTGACTGACGTGGCGCTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.40%	0.04%	0.00%	NA
All Indica	2759	75.80%	24.10%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	74.00%	26.00%	0.00%	0.00%	NA
Indica III	913	58.30%	41.60%	0.11%	0.00%	NA
Indica Intermediate	786	83.20%	16.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606936078	C -> T	LOC_Os06g12690.1	upstream_gene_variant ; 3588.0bp to feature; MODIFIER	silent_mutation	Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0606936078	C -> T	LOC_Os06g12710.1	upstream_gene_variant ; 2417.0bp to feature; MODIFIER	silent_mutation	Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0606936078	C -> T	LOC_Os06g12690.3	upstream_gene_variant ; 3588.0bp to feature; MODIFIER	silent_mutation	Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0606936078	C -> T	LOC_Os06g12690.5	upstream_gene_variant ; 3588.0bp to feature; MODIFIER	silent_mutation	Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0606936078	C -> T	LOC_Os06g12700.1	downstream_gene_variant ; 967.0bp to feature; MODIFIER	silent_mutation	Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0606936078	C -> T	LOC_Os06g12690-LOC_Os06g12700	intergenic_region ; MODIFIER	silent_mutation	Average:58.517; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606936078	5.44E-07	1.51E-09	mr1377	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078	1.48E-07	1.48E-07	mr1377	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078	NA	1.20E-06	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078	NA	1.99E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606936078	NA	4.10E-06	mr1691	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251