Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606257601:

Variant ID: vg0606257601 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6257601
Reference Allele: A	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGAGCTCCTCAGCCTCTCCACCCCACGAGACCAATGCCACCTATGCTAGTCCCAACAGTGGGAGGGAAACACCGCCACCGCCACCGCCGTGGGCTTCCC[A/C,G]
CCGGCTATGGAGCTATGACGCCCACGGAAGCCTTAGCCGCCACCACCTCCTCTGTCGAGATGGCCTCCCGCCACCCCTTGCCAGTACCTGCTGTCCATAT

Reverse complement sequence

ATATGGACAGCAGGTACTGGCAAGGGGTGGCGGGAGGCCATCTCGACAGAGGAGGTGGTGGCGGCTAAGGCTTCCGTGGGCGTCATAGCTCCATAGCCGG[T/G,C]
GGGAAGCCCACGGCGGTGGCGGTGGCGGTGTTTCCCTCCCACTGTTGGGACTAGCATAGGTGGCATTGGTCTCGTGGGGTGGAGAGGCTGAGGAGCTCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	39.10%	0.00%	0.00%	G: 0.06%
All Indica	2759	81.00%	18.90%	0.00%	0.00%	G: 0.07%
All Japonica	1512	21.90%	78.10%	0.00%	0.00%	NA
Aus	269	94.10%	5.60%	0.00%	0.00%	G: 0.37%
Indica I	595	68.20%	31.80%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	79.20%	20.60%	0.00%	0.00%	G: 0.22%
Indica Intermediate	786	82.30%	17.70%	0.00%	0.00%	NA
Temperate Japonica	767	2.20%	97.80%	0.00%	0.00%	NA
Tropical Japonica	504	54.00%	46.00%	0.00%	0.00%	NA
Japonica Intermediate	241	17.40%	82.60%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606257601	A -> C	LOC_Os06g11812.1	upstream_gene_variant ; 3084.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> C	LOC_Os06g11800.1	downstream_gene_variant ; 3893.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> C	LOC_Os06g11820.1	downstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> C	LOC_Os06g11830.1	downstream_gene_variant ; 831.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> C	LOC_Os06g11820-LOC_Os06g11830	intergenic_region ; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> G	LOC_Os06g11812.1	upstream_gene_variant ; 3084.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> G	LOC_Os06g11800.1	downstream_gene_variant ; 3893.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> G	LOC_Os06g11820.1	downstream_gene_variant ; 849.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> G	LOC_Os06g11830.1	downstream_gene_variant ; 831.0bp to feature; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N
vg0606257601	A -> G	LOC_Os06g11820-LOC_Os06g11830	intergenic_region ; MODIFIER	silent_mutation	Average:73.981; most accessible tissue: Zhenshan97 young leaf, score: 85.184	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606257601	NA	5.92E-06	mr1294_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	NA	8.76E-07	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	7.36E-06	7.36E-06	mr1418_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	2.52E-06	2.52E-06	mr1419_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	NA	1.21E-06	mr1420_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	1.51E-06	1.51E-06	mr1488_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	NA	2.29E-07	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	NA	9.36E-06	mr1779_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	NA	3.51E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606257601	NA	1.52E-06	mr1824_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251