Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605857548:

Variant ID: vg0605857548 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5857548
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAAGTTGATCGCAAAGGTCGTCATTTCTACAGTGTATCCAGTGTGAAAGAGCAAAAGAAATGCTGACGAATGTATAGTACTTTACATGTTTCACAGAT[A/C]
ACAGTTTCAGGAAAGGGAATTTATCCAATTCAGGATATTGTTGGTACCAGAGATATTGTACACTACAGACATGCTTCCCTGATGCAGAAGACGCTCTTGA

Reverse complement sequence

TCAAGAGCGTCTTCTGCATCAGGGAAGCATGTCTGTAGTGTACAATATCTCTGGTACCAACAATATCCTGAATTGGATAAATTCCCTTTCCTGAAACTGT[T/G]
ATCTGTGAAACATGTAAAGTACTATACATTCGTCAGCATTTCTTTTGCTCTTTCACACTGGATACACTGTAGAAATGACGACCTTTGCGATCAACTTTAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	36.30%	0.11%	0.28%	NA
All Indica	2759	65.30%	34.20%	0.11%	0.36%	NA
All Japonica	1512	75.30%	24.50%	0.07%	0.13%	NA
Aus	269	1.50%	98.50%	0.00%	0.00%	NA
Indica I	595	91.10%	8.90%	0.00%	0.00%	NA
Indica II	465	41.10%	57.60%	0.43%	0.86%	NA
Indica III	913	60.10%	39.40%	0.11%	0.33%	NA
Indica Intermediate	786	66.20%	33.50%	0.00%	0.38%	NA
Temperate Japonica	767	99.10%	0.80%	0.00%	0.13%	NA
Tropical Japonica	504	41.90%	57.70%	0.20%	0.20%	NA
Japonica Intermediate	241	69.70%	30.30%	0.00%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	52.20%	45.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605857548	A -> C	LOC_Os06g11170.1	3_prime_UTR_variant ; 180.0bp to feature; MODIFIER	silent_mutation	Average:92.017; most accessible tissue: Callus, score: 97.774	N	N	N	N
vg0605857548	A -> C	LOC_Os06g11170.2	3_prime_UTR_variant ; 180.0bp to feature; MODIFIER	silent_mutation	Average:92.017; most accessible tissue: Callus, score: 97.774	N	N	N	N
vg0605857548	A -> C	LOC_Os06g11160.1	downstream_gene_variant ; 2879.0bp to feature; MODIFIER	silent_mutation	Average:92.017; most accessible tissue: Callus, score: 97.774	N	N	N	N
vg0605857548	A -> C	LOC_Os06g11180.1	downstream_gene_variant ; 4615.0bp to feature; MODIFIER	silent_mutation	Average:92.017; most accessible tissue: Callus, score: 97.774	N	N	N	N
vg0605857548	A -> DEL	N	N	silent_mutation	Average:92.017; most accessible tissue: Callus, score: 97.774	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0605857548	A	C	0.0	0.01	0.0	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605857548	NA	4.19E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	3.52E-06	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	8.71E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	5.45E-08	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	4.14E-09	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	1.19E-06	NA	mr1608	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	3.32E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	9.65E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	4.03E-06	mr1725	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	1.12E-06	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	1.19E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	5.33E-06	5.33E-06	mr1581_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	4.33E-06	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	1.50E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548	NA	6.31E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251