Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605674708:

Variant ID: vg0605674708 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5674708
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

GCTACATATTTGTAACCAGATGCATCACGAACTTCAAGATGTATGTGTGCATGACAGGTGAGACCAAGTATTAATTGTGTAGTATATGTTTATTGGTAAC[G/A]
GCTTTGTTCGGCTACACTCATTTTTACTGTGTTGTAGCCAACAGCCACAGTGTTTTCTTTGTGCTAAATATAGTAGCCGAACAAGCCGAAAATTGGCTAT

Reverse complement sequence

ATAGCCAATTTTCGGCTTGTTCGGCTACTATATTTAGCACAAAGAAAACACTGTGGCTGTTGGCTACAACACAGTAAAAATGAGTGTAGCCGAACAAAGC[C/T]
GTTACCAATAAACATATACTACACAATTAATACTTGGTCTCACCTGTCATGCACACATACATCTTGAAGTTCGTGATGCATCTGGTTACAAATATGTAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.20%	29.60%	0.32%	38.93%	NA
All Indica	2759	3.80%	33.70%	0.40%	62.05%	NA
All Japonica	1512	77.90%	20.80%	0.07%	1.26%	NA
Aus	269	57.60%	38.70%	0.00%	3.72%	NA
Indica I	595	2.50%	9.10%	0.50%	87.90%	NA
Indica II	465	2.20%	59.60%	0.22%	38.06%	NA
Indica III	913	2.80%	38.70%	0.11%	58.38%	NA
Indica Intermediate	786	7.00%	31.30%	0.76%	60.94%	NA
Temperate Japonica	767	98.30%	0.80%	0.00%	0.91%	NA
Tropical Japonica	504	52.20%	47.40%	0.00%	0.40%	NA
Japonica Intermediate	241	66.80%	28.60%	0.41%	4.15%	NA
VI/Aromatic	96	7.30%	10.40%	2.08%	80.21%	NA
Intermediate	90	30.00%	44.40%	1.11%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605674708	G -> A	LOC_Os06g10880.2	upstream_gene_variant ; 2372.0bp to feature; MODIFIER	silent_mutation	Average:38.25; most accessible tissue: Callus, score: 93.226	N	N	N	N
vg0605674708	G -> A	LOC_Os06g10880.1	upstream_gene_variant ; 2372.0bp to feature; MODIFIER	silent_mutation	Average:38.25; most accessible tissue: Callus, score: 93.226	N	N	N	N
vg0605674708	G -> A	LOC_Os06g10880.3	upstream_gene_variant ; 2372.0bp to feature; MODIFIER	silent_mutation	Average:38.25; most accessible tissue: Callus, score: 93.226	N	N	N	N
vg0605674708	G -> A	LOC_Os06g10870-LOC_Os06g10880	intergenic_region ; MODIFIER	silent_mutation	Average:38.25; most accessible tissue: Callus, score: 93.226	N	N	N	N
vg0605674708	G -> DEL	N	N	silent_mutation	Average:38.25; most accessible tissue: Callus, score: 93.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605674708	2.59E-06	NA	mr1201	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605674708	7.10E-06	NA	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605674708	1.28E-06	NA	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605674708	9.26E-06	NA	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251