Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605322089:

Variant ID: vg0605322089 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5322089
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCATCTTTCGTCGGTCGGCCGAATTCCACGATAGTCCCGGATGCAATAAAAACCGGGGCTAAAGATGATCTTTAGTCTTGGTTAAAAAGGGTAACGG[G/A]
CATATTTGATCTTTAGTCCCGGTTGGTAACACCAACCAGGACTAAAGATGATCTTTAGTCCCGGTTCAAATGCTGTCAGGGCCTGTCAGGCCCCCCGGAT

Reverse complement sequence

ATCCGGGGGGCCTGACAGGCCCTGACAGCATTTGAACCGGGACTAAAGATCATCTTTAGTCCTGGTTGGTGTTACCAACCGGGACTAAAGATCAAATATG[C/T]
CCGTTACCCTTTTTAACCAAGACTAAAGATCATCTTTAGCCCCGGTTTTTATTGCATCCGGGACTATCGTGGAATTCGGCCGACCGACGAAAGATGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.60%	8.10%	1.35%	0.00%	NA
All Indica	2759	97.80%	1.60%	0.62%	0.00%	NA
All Japonica	1512	78.30%	19.00%	2.65%	0.00%	NA
Aus	269	84.80%	13.80%	1.49%	0.00%	NA
Indica I	595	98.70%	0.00%	1.34%	0.00%	NA
Indica II	465	98.10%	1.50%	0.43%	0.00%	NA
Indica III	913	99.20%	0.70%	0.11%	0.00%	NA
Indica Intermediate	786	95.40%	3.80%	0.76%	0.00%	NA
Temperate Japonica	767	96.60%	1.70%	1.69%	0.00%	NA
Tropical Japonica	504	54.20%	41.90%	3.97%	0.00%	NA
Japonica Intermediate	241	70.50%	26.60%	2.90%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	14.40%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605322089	G -> A	LOC_Os06g10355.1	upstream_gene_variant ; 3078.0bp to feature; MODIFIER	silent_mutation	Average:32.193; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0605322089	G -> A	LOC_Os06g10360.1	upstream_gene_variant ; 1041.0bp to feature; MODIFIER	silent_mutation	Average:32.193; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0605322089	G -> A	LOC_Os06g10355-LOC_Os06g10360	intergenic_region ; MODIFIER	silent_mutation	Average:32.193; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605322089	3.01E-08	NA	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	3.07E-07	7.45E-07	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	1.33E-10	3.44E-08	mr1274	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	2.84E-08	6.78E-07	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	1.49E-08	1.34E-08	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	3.81E-10	7.62E-07	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	NA	5.75E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605322089	NA	9.74E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251