Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605205203:

Variant ID: vg0605205203 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 5205203
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.26, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAGTTAAAGCTCTACTAAAGGTCTGTTTGGCATAGTGGAGCTAGAGCTCAGCCAAACAGCTCCACCTAAAATAAGAGCGAAGCTTGGTAGAGCTCTCT[T/C]
ACAAAATGAGATGAAGCTCCACAACTTTATTTCAGATCCAAATCCTGAAGCTAAATTTATAATTGGAGCTCTATCTAACCGACGCTAAACAGACATGGAT

Reverse complement sequence

ATCCATGTCTGTTTAGCGTCGGTTAGATAGAGCTCCAATTATAAATTTAGCTTCAGGATTTGGATCTGAAATAAAGTTGTGGAGCTTCATCTCATTTTGT[A/G]
AGAGAGCTCTACCAAGCTTCGCTCTTATTTTAGGTGGAGCTGTTTGGCTGAGCTCTAGCTCCACTATGCCAAACAGACCTTTAGTAGAGCTTTAACTCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.20%	32.30%	0.13%	0.30%	NA
All Indica	2759	76.80%	22.90%	0.07%	0.14%	NA
All Japonica	1512	47.20%	52.00%	0.13%	0.66%	NA
Aus	269	70.60%	29.40%	0.00%	0.00%	NA
Indica I	595	63.00%	37.00%	0.00%	0.00%	NA
Indica II	465	97.20%	2.40%	0.00%	0.43%	NA
Indica III	913	75.20%	24.60%	0.00%	0.11%	NA
Indica Intermediate	786	77.10%	22.50%	0.25%	0.13%	NA
Temperate Japonica	767	47.50%	51.60%	0.13%	0.78%	NA
Tropical Japonica	504	47.20%	52.00%	0.00%	0.79%	NA
Japonica Intermediate	241	46.50%	53.10%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	30.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0605205203	T -> C	LOC_Os06g10170.1	downstream_gene_variant ; 3478.0bp to feature; MODIFIER	silent_mutation	Average:97.665; most accessible tissue: Minghui63 young leaf, score: 99.243	N	N	N	N
vg0605205203	T -> C	LOC_Os06g10170.2	downstream_gene_variant ; 3478.0bp to feature; MODIFIER	silent_mutation	Average:97.665; most accessible tissue: Minghui63 young leaf, score: 99.243	N	N	N	N
vg0605205203	T -> C	LOC_Os06g10160-LOC_Os06g10170	intergenic_region ; MODIFIER	silent_mutation	Average:97.665; most accessible tissue: Minghui63 young leaf, score: 99.243	N	N	N	N
vg0605205203	T -> DEL	N	N	silent_mutation	Average:97.665; most accessible tissue: Minghui63 young leaf, score: 99.243	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0605205203	T	C	-0.04	-0.04	-0.01	-0.02	-0.02	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0605205203	8.81E-08	4.58E-14	mr1201	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	3.05E-13	2.55E-30	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	4.06E-07	1.03E-11	mr1219	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	9.08E-11	4.00E-25	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	5.86E-06	6.94E-12	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	2.89E-13	3.84E-27	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	3.12E-08	7.59E-12	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	5.44E-12	2.60E-24	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	1.58E-06	1.19E-09	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	4.76E-10	2.10E-21	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	2.17E-06	1.96E-11	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605205203	2.54E-10	6.86E-24	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251