Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605049749:

Variant ID: vg0605049749 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5049749
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCGTCATTGTGTCCGTGCACAAGCTTAGGACATGTACAGCGGTTTATATTAGTGGTATCTTTATTGCCATGCAATTAAATTTGATGACATGGAAGAAA[A/G]
AGAAAGGAGCATGGTTGTTATGCATGATAATGCTCAGAGTCGACTCTTAGCATTTATTAGAGCAAATTTTGTTGCATGGTGATGAAAGAAAGGAAAGAAG

Reverse complement sequence

CTTCTTTCCTTTCTTTCATCACCATGCAACAAAATTTGCTCTAATAAATGCTAAGAGTCGACTCTGAGCATTATCATGCATAACAACCATGCTCCTTTCT[T/C]
TTTCTTCCATGTCATCAAATTTAATTGCATGGCAATAAAGATACCACTAATATAAACCGCTGTACATGTCCTAAGCTTGTGCACGGACACAATGACGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.30% 20.10% 0.51% 0.08% NA
All Indica  2759 72.30% 27.50% 0.07% 0.14% NA
All Japonica  1512 88.30% 10.30% 1.39% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 57.50% 42.00% 0.17% 0.34% NA
Indica II  465 93.10% 6.90% 0.00% 0.00% NA
Indica III  913 70.90% 29.00% 0.00% 0.11% NA
Indica Intermediate  786 72.80% 27.00% 0.13% 0.13% NA
Temperate Japonica  767 86.80% 10.70% 2.48% 0.00% NA
Tropical Japonica  504 88.50% 11.30% 0.20% 0.00% NA
Japonica Intermediate  241 92.50% 7.10% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605049749 A -> G LOC_Os06g09900.1 upstream_gene_variant ; 3502.0bp to feature; MODIFIER silent_mutation Average:79.562; most accessible tissue: Minghui63 flower, score: 89.427 N N N N
vg0605049749 A -> G LOC_Os06g09910.1 downstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:79.562; most accessible tissue: Minghui63 flower, score: 89.427 N N N N
vg0605049749 A -> G LOC_Os06g09910.2 downstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:79.562; most accessible tissue: Minghui63 flower, score: 89.427 N N N N
vg0605049749 A -> G LOC_Os06g09900-LOC_Os06g09910 intergenic_region ; MODIFIER silent_mutation Average:79.562; most accessible tissue: Minghui63 flower, score: 89.427 N N N N
vg0605049749 A -> DEL N N silent_mutation Average:79.562; most accessible tissue: Minghui63 flower, score: 89.427 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605049749 A G 0.01 0.02 0.01 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605049749 NA 1.84E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0605049749 2.57E-11 8.21E-23 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 3.46E-08 1.77E-21 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 1.81E-09 3.99E-18 mr1219 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 NA 4.42E-18 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 1.31E-09 1.88E-22 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 1.65E-06 7.74E-19 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 7.79E-10 2.85E-19 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 2.02E-08 2.37E-19 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 4.30E-09 1.40E-15 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 7.92E-07 2.76E-16 mr1219_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 1.05E-09 4.78E-21 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605049749 5.00E-07 9.37E-19 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251