Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604548114:

Variant ID: vg0604548114 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4548114
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCCTCCTCGCGGCCGTGCCGGCCCATTAGGCTCGCCCGAGCTGCGCAAGTCCCTCGAGCCGCGCCAATGCCACCCGAGACAAGTCTGATTCACATCTCT[C/T]
GTCCATTTCCTTTTCCAAAGGATTTAATAAATCCTTTTCCTTTAGACAGAAAATACAAATAATCTTAGGAAATCCATATCTCCTCAACCGCTCGCCCGAT

Reverse complement sequence

ATCGGGCGAGCGGTTGAGGAGATATGGATTTCCTAAGATTATTTGTATTTTCTGTCTAAAGGAAAAGGATTTATTAAATCCTTTGGAAAAGGAAATGGAC[G/A]
AGAGATGTGAATCAGACTTGTCTCGGGTGGCATTGGCGCGGCTCGAGGGACTTGCGCAGCTCGGGCGAGCCTAATGGGCCGGCACGGCCGCGAGGAGGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	7.60%	0.32%	3.70%	NA
All Indica	2759	94.90%	0.60%	0.36%	4.17%	NA
All Japonica	1512	74.10%	22.20%	0.26%	3.37%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	75.50%	2.20%	1.08%	21.29%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	0.60%	0.64%	2.04%	NA
Temperate Japonica	767	83.20%	16.30%	0.13%	0.39%	NA
Tropical Japonica	504	61.50%	30.00%	0.40%	8.13%	NA
Japonica Intermediate	241	71.80%	24.90%	0.41%	2.90%	NA
VI/Aromatic	96	94.80%	4.20%	0.00%	1.04%	NA
Intermediate	90	84.40%	5.60%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604548114	C -> T	LOC_Os06g09030.1	upstream_gene_variant ; 925.0bp to feature; MODIFIER	silent_mutation	Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0604548114	C -> T	LOC_Os06g09040.1	downstream_gene_variant ; 3763.0bp to feature; MODIFIER	silent_mutation	Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0604548114	C -> T	LOC_Os06g09030-LOC_Os06g09040	intergenic_region ; MODIFIER	silent_mutation	Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0604548114	C -> DEL	N	N	silent_mutation	Average:48.906; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604548114	NA	6.89E-07	mr1636	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604548114	5.70E-07	7.32E-08	mr1766	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251