Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604494709:

Variant ID: vg0604494709 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4494709
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTTACTTAAATATTATTAAATAGATACCTTGTTGTCTTAAGATTTTGAAAGACCAAACCTTATCACCCCCGTATTTCTAATTAAATAGTTTTTAAAA[A/G]
TCACACCAGTTACTATCCCTTACTTTTGTCATATCTTACTTTTGTCATATCCTTCTTTATTTGTTTGCTCAATCTATCCCGGGCGGGGGAGTGATGTGGG

Reverse complement sequence

CCCACATCACTCCCCCGCCCGGGATAGATTGAGCAAACAAATAAAGAAGGATATGACAAAAGTAAGATATGACAAAAGTAAGGGATAGTAACTGGTGTGA[T/C]
TTTTAAAAACTATTTAATTAGAAATACGGGGGTGATAAGGTTTGGTCTTTCAAAATCTTAAGACAACAAGGTATCTATTTAATAATATTTAAGTAAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 14.60% 0.28% 11.76% NA
All Indica  2759 83.90% 0.70% 0.14% 15.19% NA
All Japonica  1512 48.90% 44.00% 0.33% 6.75% NA
Aus  269 94.40% 0.00% 0.00% 5.58% NA
Indica I  595 95.10% 0.70% 0.17% 4.03% NA
Indica II  465 41.30% 0.90% 0.43% 57.42% NA
Indica III  913 99.10% 0.10% 0.00% 0.77% NA
Indica Intermediate  786 83.10% 1.40% 0.13% 15.39% NA
Temperate Japonica  767 22.40% 76.50% 0.65% 0.39% NA
Tropical Japonica  504 79.00% 3.40% 0.00% 17.66% NA
Japonica Intermediate  241 70.10% 25.70% 0.00% 4.15% NA
VI/Aromatic  96 93.80% 0.00% 3.12% 3.12% NA
Intermediate  90 73.30% 6.70% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604494709 A -> G LOC_Os06g08910.1 upstream_gene_variant ; 800.0bp to feature; MODIFIER silent_mutation Average:43.034; most accessible tissue: Callus, score: 87.192 N N N N
vg0604494709 A -> G LOC_Os06g08920.1 upstream_gene_variant ; 3196.0bp to feature; MODIFIER silent_mutation Average:43.034; most accessible tissue: Callus, score: 87.192 N N N N
vg0604494709 A -> G LOC_Os06g08910.2 upstream_gene_variant ; 831.0bp to feature; MODIFIER silent_mutation Average:43.034; most accessible tissue: Callus, score: 87.192 N N N N
vg0604494709 A -> G LOC_Os06g08910.3 upstream_gene_variant ; 779.0bp to feature; MODIFIER silent_mutation Average:43.034; most accessible tissue: Callus, score: 87.192 N N N N
vg0604494709 A -> G LOC_Os06g08910-LOC_Os06g08920 intergenic_region ; MODIFIER silent_mutation Average:43.034; most accessible tissue: Callus, score: 87.192 N N N N
vg0604494709 A -> DEL N N silent_mutation Average:43.034; most accessible tissue: Callus, score: 87.192 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0604494709 A G 0.01 0.0 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604494709 2.15E-10 1.01E-32 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 4.40E-07 6.08E-20 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 9.61E-17 3.71E-51 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 1.33E-09 6.84E-19 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 NA 3.20E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 2.05E-07 5.99E-29 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 NA 2.39E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 7.28E-15 2.70E-42 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 1.55E-08 5.52E-15 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 NA 5.83E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 1.59E-10 2.30E-31 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 5.00E-07 1.56E-15 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 2.04E-12 7.30E-39 mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 1.59E-07 8.66E-22 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 1.04E-23 4.15E-61 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 9.74E-12 7.92E-20 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 1.74E-06 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 3.75E-08 2.69E-31 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 NA 5.43E-16 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 4.06E-13 2.86E-39 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604494709 4.74E-07 4.11E-12 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251