Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604342875:

Variant ID: vg0604342875 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4342875
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGCAAGTTGGCCATTGAGGCCGAAAGGGCGGTGGCGTGGAGGTGGGTGAGGTGATCATTTGATAGCAACGTGTGCTACAATGCCATGGTTTTTATAG[A/G]
GGAAGAAGAAGGAGAGGGGAGGTAGAAGCTGGAGAGGAGGAAGCAAGAAAAAAAGGCGGGAGGCCTAACTGCTGTAGAAAGGGATTTTCAATTTGGCGCC

Reverse complement sequence

GGCGCCAAATTGAAAATCCCTTTCTACAGCAGTTAGGCCTCCCGCCTTTTTTTCTTGCTTCCTCCTCTCCAGCTTCTACCTCCCCTCTCCTTCTTCTTCC[T/C]
CTATAAAAACCATGGCATTGTAGCACACGTTGCTATCAAATGATCACCTCACCCACCTCCACGCCACCGCCCTTTCGGCCTCAATGGCCAACTTGCTCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.10% 20.30% 1.80% 55.82% NA
All Indica  2759 10.80% 1.70% 2.57% 84.89% NA
All Japonica  1512 36.50% 58.90% 0.60% 3.97% NA
Aus  269 31.20% 0.70% 0.74% 67.29% NA
Indica I  595 2.00% 1.80% 2.69% 93.45% NA
Indica II  465 29.20% 3.70% 3.01% 64.09% NA
Indica III  913 5.00% 0.20% 2.63% 92.11% NA
Indica Intermediate  786 13.40% 2.20% 2.16% 82.32% NA
Temperate Japonica  767 3.40% 95.60% 0.39% 0.65% NA
Tropical Japonica  504 81.50% 9.30% 0.99% 8.13% NA
Japonica Intermediate  241 47.70% 46.10% 0.41% 5.81% NA
VI/Aromatic  96 75.00% 7.30% 2.08% 15.62% NA
Intermediate  90 41.10% 13.30% 1.11% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604342875 A -> G LOC_Os06g08710.1 upstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:76.107; most accessible tissue: Minghui63 root, score: 96.698 N N N N
vg0604342875 A -> G LOC_Os06g08720.1 downstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:76.107; most accessible tissue: Minghui63 root, score: 96.698 N N N N
vg0604342875 A -> G LOC_Os06g08720.2 downstream_gene_variant ; 3043.0bp to feature; MODIFIER silent_mutation Average:76.107; most accessible tissue: Minghui63 root, score: 96.698 N N N N
vg0604342875 A -> G LOC_Os06g08720.3 downstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:76.107; most accessible tissue: Minghui63 root, score: 96.698 N N N N
vg0604342875 A -> G LOC_Os06g08710-LOC_Os06g08720 intergenic_region ; MODIFIER silent_mutation Average:76.107; most accessible tissue: Minghui63 root, score: 96.698 N N N N
vg0604342875 A -> DEL N N silent_mutation Average:76.107; most accessible tissue: Minghui63 root, score: 96.698 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0604342875 A G 0.02 0.03 0.04 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604342875 NA 3.15E-06 mr1050 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 3.21E-09 7.09E-30 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 6.31E-09 4.84E-24 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 7.25E-31 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 9.49E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 4.30E-06 3.26E-56 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 2.00E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 4.03E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 2.50E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 6.16E-26 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 6.15E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 1.01E-07 2.01E-28 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 8.81E-06 6.11E-15 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 4.79E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 1.45E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 1.26E-13 2.06E-37 mr1115_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 5.79E-09 8.94E-24 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 1.30E-06 6.05E-34 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 5.04E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 5.05E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 2.28E-12 4.59E-75 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 5.16E-07 1.94E-18 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 5.80E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 1.79E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 1.76E-08 5.20E-31 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 3.36E-06 4.09E-16 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 2.15E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 1.23E-28 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 1.44E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604342875 NA 3.78E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251