Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604329275:

Variant ID: vg0604329275 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4329275
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCTCCGACTTCGGCGTGTCGAAGCTGGTGGCGCAGCAGGAGGATGCCAAAGATCCAGACGCCATTGACGACGACGACGACGACGCATCATCCACTCCT[T/C]
ATCCACGCAGCTCCATCACTCGATTGCTCCAAGGCTCCGTCGGCTACATCGCTCCCGGTAATCGATCAATCCCGTATCTTCACAAGAAATAGTCCAATTC

Reverse complement sequence

GAATTGGACTATTTCTTGTGAAGATACGGGATTGATCGATTACCGGGAGCGATGTAGCCGACGGAGCCTTGGAGCAATCGAGTGATGGAGCTGCGTGGAT[A/G]
AGGAGTGGATGATGCGTCGTCGTCGTCGTCGTCAATGGCGTCTGGATCTTTGGCATCCTCCTGCTGCGCCACCAGCTTCGACACGCCGAAGTCGGAGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.60% 0.02% 0.00% NA
All Indica  2759 94.50% 5.50% 0.00% 0.00% NA
All Japonica  1512 41.10% 58.90% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 96.90% 3.10% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.70% 0.00% 0.00% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 91.10% 8.90% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.90% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604329275 T -> C LOC_Os06g08680.1 upstream_gene_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:71.915; most accessible tissue: Zhenshan97 flag leaf, score: 87.282 N N N N
vg0604329275 T -> C LOC_Os06g08670.1 downstream_gene_variant ; 3992.0bp to feature; MODIFIER silent_mutation Average:71.915; most accessible tissue: Zhenshan97 flag leaf, score: 87.282 N N N N
vg0604329275 T -> C LOC_Os06g08690.1 downstream_gene_variant ; 2241.0bp to feature; MODIFIER silent_mutation Average:71.915; most accessible tissue: Zhenshan97 flag leaf, score: 87.282 N N N N
vg0604329275 T -> C LOC_Os06g08670-LOC_Os06g08680 intergenic_region ; MODIFIER silent_mutation Average:71.915; most accessible tissue: Zhenshan97 flag leaf, score: 87.282 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0604329275 T C -0.13 -0.07 -0.03 -0.01 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604329275 NA 3.87E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 2.26E-09 5.01E-28 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 3.04E-09 3.16E-24 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 1.53E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 3.79E-10 1.07E-53 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 2.88E-14 mr1241 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 8.73E-08 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 3.31E-06 mr1606 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 3.34E-07 5.07E-26 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 1.70E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 1.57E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 4.91E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 4.14E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 1.11E-09 2.88E-28 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 5.41E-06 4.41E-15 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 1.32E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 5.67E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 1.90E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 3.50E-08 5.42E-31 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 1.18E-07 2.55E-22 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 1.14E-07 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 5.86E-12 2.34E-66 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 2.20E-06 4.21E-18 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 3.74E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 2.25E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 2.42E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 7.97E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 7.35E-06 1.84E-26 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 2.56E-14 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 8.53E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 3.41E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 2.76E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604329275 NA 7.59E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251