Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603928595:

Variant ID: vg0603928595 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3928595
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTCTAGCCTGGTACATTTGCATTCTTGGATGATTGATCGATCATTCATACTTGCCGGCTGCAGTGGTTCGGTCTGATTGGAGATTTCTGATCTCTAGG[A/G]
GAAAATCGACAAGAGGACGGTTTTGGTTTTGGATGCATTCTTATTTGTAATAAGTGGGTGTGTAAATTACAATACGAGTAGTGGGTGTTAGAAGTACAAA

Reverse complement sequence

TTTGTACTTCTAACACCCACTACTCGTATTGTAATTTACACACCCACTTATTACAAATAAGAATGCATCCAAAACCAAAACCGTCCTCTTGTCGATTTTC[T/C]
CCTAGAGATCAGAAATCTCCAATCAGACCGAACCACTGCAGCCGGCAAGTATGAATGATCGATCAATCATCCAAGAATGCAAATGTACCAGGCTAGACAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 13.70% 0.04% 0.00% NA
All Indica  2759 86.50% 13.50% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.07% 0.00% NA
Aus  269 5.90% 94.10% 0.00% 0.00% NA
Indica I  595 78.80% 21.20% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 91.80% 8.20% 0.00% 0.00% NA
Indica Intermediate  786 80.50% 19.50% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603928595 A -> G LOC_Os06g08090.1 upstream_gene_variant ; 679.0bp to feature; MODIFIER silent_mutation Average:71.085; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0603928595 A -> G LOC_Os06g08100.1 upstream_gene_variant ; 3497.0bp to feature; MODIFIER silent_mutation Average:71.085; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0603928595 A -> G LOC_Os06g08090.2 upstream_gene_variant ; 650.0bp to feature; MODIFIER silent_mutation Average:71.085; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0603928595 A -> G LOC_Os06g08080.1 downstream_gene_variant ; 4186.0bp to feature; MODIFIER silent_mutation Average:71.085; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0603928595 A -> G LOC_Os06g08090-LOC_Os06g08100 intergenic_region ; MODIFIER silent_mutation Average:71.085; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0603928595 A G 0.01 0.01 0.0 0.01 0.04 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603928595 NA 4.82E-08 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 3.32E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.62E-08 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 7.98E-07 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.52E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.42E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 5.46E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 5.51E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 3.20E-06 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.96E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 3.94E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 3.96E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.88E-09 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 9.32E-08 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 2.66E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.62E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 1.60E-08 mr1906 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 2.75E-16 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 5.32E-06 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 6.03E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 4.23E-07 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 2.80E-07 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 7.07E-06 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 7.93E-08 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603928595 NA 6.80E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251